Anatomy & Physiology: The Unity of Form and Function
8th Edition
ISBN: 9781259277726
Author: Kenneth S. Saladin Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 4, Problem 5WWTS
Summary Introduction
Introduction:
DNA is a genetic material, consisting of a long stretch of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence
3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'
Draw each of the following base pairs: A-T, G-C, and U-A
please identify structure information about this gene which is adgrg1/gpr56. You can identify anything about the molecule including chains, atoms, etc.
Chapter 4 Solutions
Anatomy & Physiology: The Unity of Form and Function
Ch. 4.1 - What are the three components of a nucleotide?...Ch. 4.1 - What governs the pattern of base paring in DNA?Ch. 4.1 - what is the difference between DNA and chromatin?Ch. 4.1 - Summarize the structural and functional...Ch. 4.1 - The general name of the monomers that compose DNA...Ch. 4.1 - Prob. 2AYLOCh. 4.1 - Prob. 3AYLOCh. 4.1 - How DNA and protein are combined to form...Ch. 4.1 - Prob. 5AYLOCh. 4.1 - HOW RNA differs from DNA in structure and...
Ch. 4.2 - Prob. 5BYGOCh. 4.2 - Describe the roles of RNA polymerase ribosomes,...Ch. 4.2 - What is the difference between genetic...Ch. 4.2 - Summarize the processing of a protein from the...Ch. 4.2 - Prob. 9BYGOCh. 4.2 - Prob. 10BYGOCh. 4.2 - Prob. 1AYLOCh. 4.2 - Prob. 2AYLOCh. 4.2 - The organization of nucleotides into DNA triplets;...Ch. 4.2 - How the genetic code relates mRNA codons to...Ch. 4.2 - The process and outcome of genetic transcription,...Ch. 4.2 - Prob. 6AYLOCh. 4.2 - Prob. 7AYLOCh. 4.2 - Prob. 8AYLOCh. 4.2 - Prob. 9AYLOCh. 4.2 - Prob. 10AYLOCh. 4.3 - Describe the genetic roles of DNA helicase and DNA...Ch. 4.3 - Explain why DNA replication is called...Ch. 4.3 - Define mutation. Explain why some mutations are...Ch. 4.3 - Prob. 14BYGOCh. 4.3 - Prob. 15BYGOCh. 4.3 - Prob. 16BYGOCh. 4.3 - Prob. 1AYLOCh. 4.3 - Semiconservative replication, the enzymes that...Ch. 4.3 - What a mutation is and how a cell detects and...Ch. 4.3 - The four stages of the cell cycle, what occurs in...Ch. 4.3 - Prob. 5AYLOCh. 4.3 - Cytokinesis and how it overlaps but differs from...Ch. 4.3 - Prob. 7AYLOCh. 4.3 - Prob. 8AYLOCh. 4.4 - Why must the carrier of a genetic disease be...Ch. 4.4 - Prob. 18BYGOCh. 4.4 - Prob. 19BYGOCh. 4.4 - Prob. 1AYLOCh. 4.4 - Organization of the karyotype; the number of...Ch. 4.4 - Prob. 3AYLOCh. 4.4 - Prob. 4AYLOCh. 4.4 - Prob. 5AYLOCh. 4.4 - Why a recessive trait can skip a generation, with...Ch. 4.4 - The differences between the genotype, genome, and...Ch. 4.4 - Prob. 8AYLOCh. 4.4 - Prob. 9AYLOCh. 4.4 - Prob. 10AYLOCh. 4.4 - Prob. 11AYLOCh. 4.4 - Prob. 12AYLOCh. 4.4 - Why it cannot be said that dominant alleles are...Ch. 4.4 - Prob. 14AYLOCh. 4 - Production of more than one phenotypic trait by a...Ch. 4 - When a ribosome reads a codon on mRNA, it must...Ch. 4 - Prob. 3TYRCh. 4 - Two genetically identical strands of a metaphase...Ch. 4 - Prob. 5TYRCh. 4 - Genetic transcription is performed by a....Ch. 4 - Prob. 7TYRCh. 4 - Prob. 8TYRCh. 4 - Semiconservative replication occurs during a....Ch. 4 - Mutagens sometimes cause no harm to cells for all...Ch. 4 - The cytoplasmic division at the end of mitosis is...Ch. 4 - Prob. 12TYRCh. 4 - Prob. 13TYRCh. 4 - Prob. 14TYRCh. 4 - Prob. 15TYRCh. 4 - Prob. 16TYRCh. 4 - Prob. 17TYRCh. 4 - The cytoplasmic granule of RNA and protein that...Ch. 4 - Prob. 19TYRCh. 4 - Prob. 20TYRCh. 4 - Prob. 1BYMVCh. 4 - Prob. 2BYMVCh. 4 - Prob. 3BYMVCh. 4 - Prob. 4BYMVCh. 4 - Prob. 5BYMVCh. 4 - Prob. 6BYMVCh. 4 - Prob. 7BYMVCh. 4 - Prob. 8BYMVCh. 4 - Prob. 9BYMVCh. 4 - Prob. 10BYMVCh. 4 - Prob. 1WWTSCh. 4 - Steroids, carbohydrates, and phospholipids are...Ch. 4 - Prob. 3WWTSCh. 4 - Prob. 4WWTSCh. 4 - Prob. 5WWTSCh. 4 - The law of complementary base pairing describes...Ch. 4 - Prob. 7WWTSCh. 4 - All mutations result m the production of defective...Ch. 4 - Prob. 9WWTSCh. 4 - Prob. 10WWTSCh. 4 - Why world the supercoiled, condensed form of...Ch. 4 - Prob. 2TYCCh. 4 - Given the information in this chapter, present an...Ch. 4 - Prob. 4TYCCh. 4 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'arrow_forwardA normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?arrow_forwardName four types of point mutations that can occur in a gene coding for a protein. Discuss the possible effect each of these can have on the protein that is produced.arrow_forward
- The protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb. How is thisdifference possible?arrow_forwardHuman Chromosome 22 (48 × 106 nucleotide pairs in length) has about 700 protein-coding genes, which average 19,000 nucleotide pairs in length and contain an average of 5.4 exons, each of which averages 266 nucleotide pairs. What fraction of the average protein-coding gene is converted into mRNA? What fraction of the chromosome do these genes occupy?arrow_forwardThe human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?arrow_forward
- Use the following DNA sequence, and write the resulting messenger RNA sequence TACTTTGAATGCGGCCGTATC?arrow_forwardYou have created three different mutations in the histoneH1 protein (HISmut1, HISmut2, HISmut3), and each of these mutations eliminate a stretch of 5 amino acids from the primary sequence. Based on the description of where you find the mutant histoneH1 proteins when you look inside a cell in each of the cases below, describe 1) what the function is of the amino acids that were removed, and 2) what is not happening with the mutant histoneH1 protein that does happen with wild type H1: 1. HISmut2 protein is found in the cytoplasm, and never in the nucleus. 2. HISmut1 protein is found in only briefly in the cytoplasm because it is very quickly sent to the proteasome. 3. HISmut3 protein is found floating freely throughout the nucleoplasm.arrow_forwarda protein with a molar mass of 3800 g/mol is given. determine the number of nucleotides contained in the gene that encoded this protein, knowing that: 20% of it are introns, the mass of a nucleotide is 300 g/mol and the mass of an amino acid is 110 g/molarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License