Concept explainers
(a)
Interpretation:
The complementary sequence for GATCAA in 5’-3’ notation should be determined.
Concept introduction:
The two stands of DNA are not identical; they are complementary to each other which results from base pairing. The base pairing takes place via hydrogen bonding between the two strands.
DNA sequencing is a process that determines the order of four bases A (adenine), T (thymine), G (guanine), C (cytosine).
(b)
Interpretation:
The complementary sequence for TCGAAC in 5’-3’ notation should be determined.
Concept introduction:
The two stands of DNA are not identical; they are complementary to each other which results from base pairing. The base pairing takes place via hydrogen bonding between the two strands.
DNA sequencing is a process that determines the order of four bases A (adenine), T (thymine), G (guanine), C (cytosine).
(c)
Interpretation:
The complementary sequence for ACGCGT in 5’-3’ notation should be determined.
Concept introduction:
The two stands of DNA are not identical; they are complementary to each other which results from base pairing. The base pairing takes place via hydrogen bonding between the two strands.
DNA sequencing is a process that determines the order of four bases A (adenine), T (thymine), G (guanine), C (cytosine).
(d)
Interpretation:
The complementary sequence for TACCAT in 5’-3’ notation should be determined.
Concept introduction:
The two stands of DNA are not identical; they are complementary to each other which results from base pairing. The base pairing takes place via hydrogen bonding between the two strands.
DNA sequencing is a process that determines the order of four bases A (adenine), T (thymine), G (guanine), C (cytosine).
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 4 Solutions
BIOCHEMISTRY
- Are the following base sequences sticky or not sticky? Each piece is written 5′ to 3′.(a) TTAGC and GCTAA(b) CGTACG and CCTTCGarrow_forwardCompute the PERCENT IDENTITY for the following pairwise sequence alignment. ACTGATGGGGG--AGACGTA ||||| ... I ||||||| ACTG--AAAAGCTAGACGTAarrow_forwardIn biochemical and structural terms, how does the cellular form of the prion protein differ from the infectious form? Can you also explain what is the biochemical basis for “infectiousness” of the prion protein?arrow_forward
- (a) How many activation cycles are needed for a protein with 150 amino acids? (b) How many initiation cycles are needed for a protein with 150 amino acids? (c) How many elongation cycles are needed for a protein with 150 amino acids? (d) How many termination cycles are needed for a protein with 150 amino acids?arrow_forwardLow-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence (-Gly-Ser-Gly-Ala-Gly-Ala-)n, where n indicates any number of repeats, shows an extended structure of stacked layers, with a repeat distance between layers that alternates between 3.5 Å and 5.7 Å. Propose a model that explains this scenario.arrow_forward5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13arrow_forward
- 2A Draw the complete structure of the trinucleotide 5'-A-G-C-3' (DNA).arrow_forwardusing, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error on the amino acid chain?arrow_forwardAssume that the translational error frequency, d, is 1 * 10–4. (a) Calculate the probability of making a perfect protein of 100 residues. (b) Repeat for a 1000-residue protein.arrow_forward
- Assume that the translational error frequency, 8, is 1 × 10-4. (a) Calculate the probability of making a perfect protein of 100 residues. (b) Repeat for a 1000-residue protein.arrow_forwardBased on the alignment of these protein sequences below, which [pairs] of the genes appear to be most similar to each other? [at least mention 2 points]; Why? [at least mention 2 points] Image of the protein sequences :arrow_forwardAre the following base sequences “sticky” (complementary) or not? All sequences are written 5′ to 3′. (a) A-C-G-G-A and T-G-C-C-T (b) G-T-G-A-C and C-A-T-G-G(c) G-T-A-T-A and A-C-G-C-Garrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)