Microbiology: Principles and Explorations
9th Edition
ISBN: 9781118743164
Author: Jacquelyn G. Black, Laura J. Black
Publisher: WILEY
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 4, Problem 13SQ
Glucose is often present in very low concentrations in environments populated by microorganisms. To import the maximum amount of available glucose, cells use:
- (a) Simple diffusion
- (b) Facilitated diffusion
- (c) Active transport
- (d) Osmosis
- (e) Receptor-mediated endocytosis
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 4 Solutions
Microbiology: Principles and Explorations
Ch. 4 - Are viruses prokaryotes? Eukaryotes? Why or why...Ch. 4 - Compare surface-to-volume ratios of prokaryotes...Ch. 4 - Prob. 1.3SCCh. 4 - Prokaryotes lack mitochondria. What structure does...Ch. 4 - Compare peptidoglycan and teichoic acid as to...Ch. 4 - What takes place in the periplasmic space? Which...Ch. 4 - Prob. 2.3SCCh. 4 - Compare the cell walls of Gram-positive,...Ch. 4 - How do bacteria move in chemotaxis? Distinguish...Ch. 4 - Prob. 3.2SC
Ch. 4 - Prob. 3.3SCCh. 4 - Distinguish between nucleus and nucleoid.Ch. 4 - Most prokaryotes lack sterols in their plasma...Ch. 4 - Prob. 4.2SCCh. 4 - Give two specific arguments that support the idea...Ch. 4 - Prob. 1CCSCh. 4 - Your roommate has noticed that you now spend most...Ch. 4 - Many of todays antibacterial drugs work by...Ch. 4 - According to the endosymbiotic theory, the...Ch. 4 - Most prokaryotes range in size from 0.5 to 2.0 m,...Ch. 4 - Attribute each of the following to either P,...Ch. 4 - Match the following bacterial morphology...Ch. 4 - Which of the following statement about the...Ch. 4 - Bacteria such as Mycoplasma that lack cell walls...Ch. 4 - Prob. 6SQCh. 4 - Prob. 7SQCh. 4 - Match the following bacterial locomotion and...Ch. 4 - Prob. 9SQCh. 4 - Prob. 10SQCh. 4 - Prob. 11SQCh. 4 - Prob. 12SQCh. 4 - Glucose is often present in very low...Ch. 4 - Prob. 14SQCh. 4 - Peptidoglycan digested from Gram-______ bacteria...Ch. 4 - Prob. 16SQCh. 4 - Prob. 17SQCh. 4 - Prob. 18SQCh. 4 - Mitosis differs from meiosis in the following ways...Ch. 4 - For each of the lettered regions identified on...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Explain how competition, predation, and mutualism differ in their effects on the interacting populations of two...
Campbell Biology (11th Edition)
Calculate the lattice energy of CaCl2 using a Born-Haber cycle and data from Appendices F and L and Table 7.5. ...
Chemistry & Chemical Reactivity
Identify each of the following reproductive barriers as prezygotic or postzygotic a. One lilac species lives on...
Campbell Essential Biology (7th Edition)
Why is petroleum jelly used in the hanging-drop procedure?
Laboratory Experiments in Microbiology (12th Edition) (What's New in Microbiology)
16.16 Consider the phylogenetic tree below with three related species (A, B, C) that share a common ancestor (l...
Genetic Analysis: An Integrated Approach (3rd Edition)
Use the key to classify each of the following described tissue types into one of the four major tissue categori...
Anatomy & Physiology (6th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
The Cell Membrane; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=AsffT7XIXbA;License: Standard youtube license