Anatomy & Physiology
5th Edition
ISBN: 9780321861580
Author: Marieb, Elaine N.
Publisher: Pearson College Div
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 3, Problem 30CYU
How do the A, P, and E ribosomal sites differ functionally during protein synthesis?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate different proteins?
What are the 3 tRNA sites on the small ribosomal subunit (just abbreviations)? What is the order of tRNA entrance and exit through the ribosome?
a) Identify three types of RNA and provide a description of each and the role they
play in protein synthesis.
(6 marks)
b) Use the DNA sequence below to answer the following questions.
3' - TACGAACGAGTGCCCCAAAATT -5'
What is the complementary DNA strand?
(1 mark)
What is the nucleotide sequence of the mRNA strand transcribed from the initial
DNA strand?
(1 mark)
Provide an alternative mRNA sequence with four changes that would translate to the
same amino acid sequence. (2 marks)
Paragraph
I
A
+ v
...
Lato (Recom... v
19px ... v
Add a File
Record Audio
Record Video
MacBook Pro
G Search or type URL
#3
2$
&
(
3
4
7
8
9
山訓
< CO
How does the transcribed mRNA convert into a functional protein?
Chapter 3 Solutions
Anatomy & Physiology
Ch. 3 - Summarize the four key points of the cell theory.Ch. 3 - How would you explain the meaning of a generalized...Ch. 3 - What basic structure do all cellular membranes...Ch. 3 - Why do phospholipids, which form the greater part...Ch. 3 - What is the importance of the glycocalyx in cell...Ch. 3 - Prob. 6CYUCh. 3 - What is the energy source for all types of...Ch. 3 - What determines the direction of any diffusion...Ch. 3 - What are the two types of facilitated diffusion...Ch. 3 - What happens when the Na+-K+ pump is...
Ch. 3 - As a cell grows, its plasma membrane expands. Does...Ch. 3 - Prob. 12CYUCh. 3 - Which vesicular transport process allows a cell to...Ch. 3 - What process establishes the resting membrane...Ch. 3 - Prob. 15CYUCh. 3 - What term is used to indicate signaling chemicals...Ch. 3 - Which organelle is the major site of ATP...Ch. 3 - What are three organelles involved in protein...Ch. 3 - Compare the functions of lysosomes and...Ch. 3 - How are microtubules and microfilaments related...Ch. 3 - Prob. 21CYUCh. 3 - Prob. 22CYUCh. 3 - If a cell ejects or loses its nucleus, what is its...Ch. 3 - What is the role of nucleoli?Ch. 3 - What is the role of nucleoli?Ch. 3 - If one of the DNA strands being replicated reads...Ch. 3 - During what phase of the cell cycle is DNA...Ch. 3 - What are three events occurring in prophase that...Ch. 3 - Codons and anticodons are both three-base...Ch. 3 - How do the A, P, and E ribosomal sites differ...Ch. 3 - What is the role of DNA in transcription?Ch. 3 - What is the importance of ubiquitin in the life of...Ch. 3 - Prob. 33CYUCh. 3 - The smallest unit capable of life by itself is (a)...Ch. 3 - Prob. 2RQCh. 3 - Prob. 3RQCh. 3 - The term used to describe the type of solution in...Ch. 3 - Osmosis always involves (a) a selectively...Ch. 3 - Prob. 6RQCh. 3 - Prob. 7RQCh. 3 - The endocytotic process in which a sampling of...Ch. 3 - Prob. 9RQCh. 3 - The nuclear substance composed of histone proteins...Ch. 3 - The information sequence that determines the...Ch. 3 - Mutations may be caused by (a) X rays, (b) certain...Ch. 3 - The phase of mitosis during which centrioles each...Ch. 3 - Final preparations for cell division are made...Ch. 3 - The RNA synthesized on one of the DNA strands is...Ch. 3 - The RNA species that travels from the nucleus to...Ch. 3 - If DNA has a sequence of AAA, then a segment of...Ch. 3 - A nerve cell and a lymphocyte are presumed to...Ch. 3 - Prob. 19RQCh. 3 - Explain why mitosis can be thought of as cellular...Ch. 3 - Contrast the roles of ER-bound ribosomes with...Ch. 3 - Cells lining the trachea have whiplike motile...Ch. 3 - Name the three phases of interphase and describe...Ch. 3 - Comment on the role of the sodium-potassium pump...Ch. 3 - Differentiate between primary and secondary active...Ch. 3 - Cell division typically yields two daughter cells,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Does mRNA bind to one or to both ribosomal subunits in the course of protein synthesis?arrow_forwardWhat are the two main steps to protein synthesis and where do they take place? What are the different types of RNA used and what are their roles? How important is nucleotide order to the process?arrow_forwardWhat factors ensure accuracy in protein synthesis? How does the level of accuracy usually attained in protein synthesis compare with that of replication or transcription?arrow_forward
- Where are tRNA and their corresponding amino acids found in the cell prior to attachment to make a protein?arrow_forwardHow does the process of protein synthesis differ in Prokaryotes and Eukaryotes? Discuss factors other than ribosome size.arrow_forwardIs there any complementarity between DNA and a transcribed mRNA? In which direction is the mRNA synthesized?arrow_forward
- Where are subunits of ribosomes synthesized and assembled?arrow_forwardSuppose that a DNA segment has the following nucleotide sequence: CTC ATA CGA TTC AAG TTA. Which of the following nucleotide sequences would be found in a complementary mRNA strand? (a) GAG UAU GAU AAC UUG AAU. (b) GAG TAT GCT AAG TTC AAT. (c) GAG UAU GCU AAG UUC AAU. (d) GUG UAU GGA UUG AAC GGU.arrow_forwardWhere does translation occur?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY