Anatomy & Physiology
5th Edition
ISBN: 9780321861580
Author: Marieb, Elaine N.
Publisher: Pearson College Div
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 3, Problem 17RQ
If DNA has a sequence of AAA, then a segment of mRNA synthesized on it will have a sequence of (a) TTT, (b) UUU, (c) GGG, (d) CCC.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Suppose that a DNA segment has the following nucleotide sequence: CTC ATA CGA TTC AAG TTA. Which of the following nucleotide sequences would be found in a complementary mRNA strand? (a) GAG UAU GAU AAC UUG AAU. (b) GAG TAT GCT AAG TTC AAT. (c) GAG UAU GCU AAG UUC AAU. (d) GUG UAU GGA UUG AAC GGU.
The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome: Choose the sequence that would correspond to that mRNA.
A: 3’ – TACGGAACG – 5’
B) 3’ – AUGCCUUGC – 5’
C) 5’ – AUGCCUUGC – 3’
D) 3’ – UACGGAACG – 5’
E) 5’ – UACGGAACG – 3’
Select the best answer or answers from the choices given: If DNA has a sequence of AAA, then a segment of mRNA synthesized on it will have a sequence of (a) TTT, (b) UUU, (c) GGG, (d) CCC.
Chapter 3 Solutions
Anatomy & Physiology
Ch. 3 - Summarize the four key points of the cell theory.Ch. 3 - How would you explain the meaning of a generalized...Ch. 3 - What basic structure do all cellular membranes...Ch. 3 - Why do phospholipids, which form the greater part...Ch. 3 - What is the importance of the glycocalyx in cell...Ch. 3 - Prob. 6CYUCh. 3 - What is the energy source for all types of...Ch. 3 - What determines the direction of any diffusion...Ch. 3 - What are the two types of facilitated diffusion...Ch. 3 - What happens when the Na+-K+ pump is...
Ch. 3 - As a cell grows, its plasma membrane expands. Does...Ch. 3 - Prob. 12CYUCh. 3 - Which vesicular transport process allows a cell to...Ch. 3 - What process establishes the resting membrane...Ch. 3 - Prob. 15CYUCh. 3 - What term is used to indicate signaling chemicals...Ch. 3 - Which organelle is the major site of ATP...Ch. 3 - What are three organelles involved in protein...Ch. 3 - Compare the functions of lysosomes and...Ch. 3 - How are microtubules and microfilaments related...Ch. 3 - Prob. 21CYUCh. 3 - Prob. 22CYUCh. 3 - If a cell ejects or loses its nucleus, what is its...Ch. 3 - What is the role of nucleoli?Ch. 3 - What is the role of nucleoli?Ch. 3 - If one of the DNA strands being replicated reads...Ch. 3 - During what phase of the cell cycle is DNA...Ch. 3 - What are three events occurring in prophase that...Ch. 3 - Codons and anticodons are both three-base...Ch. 3 - How do the A, P, and E ribosomal sites differ...Ch. 3 - What is the role of DNA in transcription?Ch. 3 - What is the importance of ubiquitin in the life of...Ch. 3 - Prob. 33CYUCh. 3 - The smallest unit capable of life by itself is (a)...Ch. 3 - Prob. 2RQCh. 3 - Prob. 3RQCh. 3 - The term used to describe the type of solution in...Ch. 3 - Osmosis always involves (a) a selectively...Ch. 3 - Prob. 6RQCh. 3 - Prob. 7RQCh. 3 - The endocytotic process in which a sampling of...Ch. 3 - Prob. 9RQCh. 3 - The nuclear substance composed of histone proteins...Ch. 3 - The information sequence that determines the...Ch. 3 - Mutations may be caused by (a) X rays, (b) certain...Ch. 3 - The phase of mitosis during which centrioles each...Ch. 3 - Final preparations for cell division are made...Ch. 3 - The RNA synthesized on one of the DNA strands is...Ch. 3 - The RNA species that travels from the nucleus to...Ch. 3 - If DNA has a sequence of AAA, then a segment of...Ch. 3 - A nerve cell and a lymphocyte are presumed to...Ch. 3 - Prob. 19RQCh. 3 - Explain why mitosis can be thought of as cellular...Ch. 3 - Contrast the roles of ER-bound ribosomes with...Ch. 3 - Cells lining the trachea have whiplike motile...Ch. 3 - Name the three phases of interphase and describe...Ch. 3 - Comment on the role of the sodium-potassium pump...Ch. 3 - Differentiate between primary and secondary active...Ch. 3 - Cell division typically yields two daughter cells,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- During protein synthesis, one amino acid binds to RNA molecules. a) What is this RNA molecule? b) Draw an example of this binding processarrow_forwardThe RNA synthesized on one of the DNA strands is (a) mRNA, (b) tRNA, (c) rRNA, (d) all of these.arrow_forwardA section of the mRNA has a nucleotide sequence of CUATAUGUTGU. How many codons does this segment of mRNA represent? a) two, b) one, c) four, d) three, e) none, this molecule is not a transcript of DNAarrow_forward
- which statement about genetic code is not true? A) mRNA is read 3 bases at a time, which are called codons. B) There is one initiator codon that codes for an amino acid. C) Each amino acid is coded for by only one codon. D) There are 3 termination codons that do not code for amino acids. E) Each codon is specific for only one amino acid. An anion has an equilibrium potential of -40 mV. What direction are the chemical and electrical forces acting on the anion at the resting membrane potential (-70 mV)? A) Both the chemical and electrical forces are directed out of the cell. B) The chemical force is directed out of the cell and the electrical force is directed into the cell. C) The chemical force is directed into the cell and the electrical force is directed out of the cell. D) There is insufficient information to answer this question. E) Both the chemical and electrical forces are directed into the cell.arrow_forwardIf a protein is made up of 1000 amino acids 1) How many nucleotides will its mRNA contain between (and including) the start and stop codon? _____ 2) How many codons will this mRNA contain? _____ 3) How many tRNA molecules will be needed to make that protein? _____arrow_forwarda) Identify three types of RNA and provide a description of each and the role they play in protein synthesis. (6 marks) b) Use the DNA sequence below to answer the following questions. 3' - TACGAACGAGTGCCCCAAAATT -5' What is the complementary DNA strand? (1 mark) What is the nucleotide sequence of the mRNA strand transcribed from the initial DNA strand? (1 mark) Provide an alternative mRNA sequence with four changes that would translate to the same amino acid sequence. (2 marks) Paragraph I A + v ... Lato (Recom... v 19px ... v Add a File Record Audio Record Video MacBook Pro G Search or type URL #3 2$ & ( 3 4 7 8 9 山訓 < COarrow_forward
- Once translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?arrow_forwardWhich statement below about mRNA is true? A)A gene's promoter sequence is transcribed into mRNA. B)Translation begins at the 5′ end of a molecule of mRNA C)mRNA is complementary to the coding strand of DNA. D)Some regions of mRNA are not translated into amino acids.arrow_forward16) PROTEIN SYNTHESIS: A) Describe the process of protein synthesis. Be sure to use transcription and translation in your answer (and explain the parts involved in each process) B) Why is RNA transcription a necessary process?arrow_forward
- Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNAarrow_forwardA triplet of bases on an mRNA molecule is known as a(n) A) amino acid. B) anticodon. C) codon. D) ribosome-binding sequence.arrow_forward(a) Describe the different stages that process of Protein synthesis. (b) using four examples of antibiotic inhibitors of translation, outlinehow the inhibition occurs.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY