(a) Interpretation: The purpose of the control plate to be exposed only to water needs to be explained. Concept introduction: Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Question

Want to see the full answer?

Answer 1

Question

Chapter 29, Problem 20P

Interpretation Introduction

(a)

Interpretation:

The purpose of the control plate to be exposed only to water needs to be explained.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Interpretation Introduction

(b)

Interpretation:

The use of known mutant in a given experiment is to be described.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Interpretation Introduction

(c)

Interpretation:

The results obtained from the experimental compound needs to be interpreted.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Interpretation Introduction

(d)

Interpretation:

Unknown liver compound used in sample D in a given experiment is to be described.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Considering DNA sequencing by the Sanger method. It is correct to say that: * A)In the traditional method, radioactively “labeled” primers are used, allowing their visualization in autoradiography. B)In the automated method, a single reaction is performed containing the four “labeled” dideoxynucleotides, each with a different fluorophore. C)In both traditional and automated methods, the fragments are resolved and interpreted according to their ionization state. D)In the automated method, di-deoxynucleotides “labeled” with the same fluorophore are used, thus allowing their interpretation based on graphs of fluorescence emission. E)Sequencing reactions can use mRNA molecules, as long as they have a polyA tail.

Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…

Restriction sites of Lambda (A) DNA - In base pairs (bp) The sites at which each of the 3 different enzymes will cut the same strand of lambda DNA are shown in the maps (see figure 3 B-D), each vertical line on the map is where the respective enzymes will cut. A DNA A (bp) 48502 10 000 20 000 30 000 40 000 9162 17 198 B Sal I 7059 14 885 28 338 35 603 42 900 (bp) Hae III 11 826 21 935 29 341 38 016 (bp) 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864 Figure 3: Restrictrion site map showing the following A) inear DNA that is not cut as reference B) DNA CLt with Sal L C) DNA cut with Hae , D) DNA cut with Eco RI 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A). Page 3 of 7 9162 17 198 Sal i (bp) 7059 14 885 28 338 35 603 42 900 Hae I (bp) 11 826 21 935 29 341 38 016 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864

Answer 2

Question

Chapter 29, Problem 20P

Interpretation Introduction

(a)

Interpretation:

The purpose of the control plate to be exposed only to water needs to be explained.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Interpretation Introduction

(b)

Interpretation:

The use of known mutant in a given experiment is to be described.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Interpretation Introduction

(c)

Interpretation:

The results obtained from the experimental compound needs to be interpreted.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Interpretation Introduction

(d)

Interpretation:

Unknown liver compound used in sample D in a given experiment is to be described.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 29, Problem 20P

Interpretation Introduction

(a)

Interpretation:

The purpose of the control plate to be exposed only to water needs to be explained.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Interpretation Introduction

(b)

Interpretation:

The use of known mutant in a given experiment is to be described.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Interpretation Introduction

(c)

Interpretation:

The results obtained from the experimental compound needs to be interpreted.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Interpretation Introduction

(d)

Interpretation:

Unknown liver compound used in sample D in a given experiment is to be described.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 29, Problem 20P

Interpretation Introduction

(a)

Interpretation:

The purpose of the control plate to be exposed only to water needs to be explained.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Interpretation Introduction

(b)

Interpretation:

The use of known mutant in a given experiment is to be described.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Interpretation Introduction

(c)

Interpretation:

The results obtained from the experimental compound needs to be interpreted.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Interpretation Introduction

(d)

Interpretation:

Unknown liver compound used in sample D in a given experiment is to be described.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 29, Problem 20P

Interpretation Introduction

(a)

Interpretation:

The purpose of the control plate to be exposed only to water needs to be explained.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Interpretation Introduction

(b)

Interpretation:

The use of known mutant in a given experiment is to be described.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Interpretation Introduction

(c)

Interpretation:

The results obtained from the experimental compound needs to be interpreted.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Interpretation Introduction

(d)

Interpretation:

Unknown liver compound used in sample D in a given experiment is to be described.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Answer 6

Chapter 29, Problem 20P

Interpretation Introduction

(a)

Interpretation:

The purpose of the control plate to be exposed only to water needs to be explained.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Answer 7

Chapter 29, Problem 20P

Interpretation Introduction

(a)

Interpretation:

The purpose of the control plate to be exposed only to water needs to be explained.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Answer 8

Interpretation Introduction

(b)

Interpretation:

The use of known mutant in a given experiment is to be described.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Answer 9

Interpretation Introduction

(b)

Interpretation:

The use of known mutant in a given experiment is to be described.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Answer 10

Interpretation Introduction

(c)

Interpretation:

The results obtained from the experimental compound needs to be interpreted.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Answer 11

Interpretation Introduction

(c)

Interpretation:

The results obtained from the experimental compound needs to be interpreted.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Answer 12

Interpretation Introduction

(d)

Interpretation:

Unknown liver compound used in sample D in a given experiment is to be described.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Answer 13

Interpretation Introduction

(d)

Interpretation:

Unknown liver compound used in sample D in a given experiment is to be described.

Concept introduction:

Ames test is used to check if the given chemical is a mutation causing agent or not i.e. it can cause mutation in the DNA of the given organism or not. This test uses bacteria that lacks histidine forming machinery.

Answer 14

Expert Solution & Answer

Answer 15

Expert Solution & Answer

Answer 16

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 17

Ch. 29 - Prob. 1P Ch. 29 - Prob. 2P Ch. 29 - Prob. 3P Ch. 29 - Prob. 4P Ch. 29 - Prob. 5P Ch. 29 - Prob. 6P Ch. 29 - Prob. 7P Ch. 29 - Prob. 8P Ch. 29 - Prob. 9P Ch. 29 - Prob. 10P

Solution Summary: The author explains the purpose of the control plate to be exposed only to water. Ames test is used to check if the chemical is a mutation causing agent or not.

Want to see the full answer?

Chapter 29 Solutions