To write:
List microorganisms cause genitourinary infections.
Given:
List of microorganisms which cause genitourinary infections.
Introduction:
Urinary tract infection is commonly caused by bacteria and occasionally caused by protozoa and
Genital infection is mostly caused by bacteria and other microorganisms, such as yeast and protozoan. They grow and cover the surface epithelial cells of the vagina. Bacterial vaginosis is a common reproductive tract infection in women, it can be transmitted through sexual contact. It causes ectopic pregnancy and infertility. The vaginal infection is characterized by genital itching and burning and pain during urination or sexual contact. It causes vaginal discharge with bad smell. Vaginal smear, serological test and PCR are used to diagnose genital infection. It can be treated with antibiotics and prevented by personal hygiene.
Want to see the full answer?
Check out a sample textbook solutionChapter 26 Solutions
Microbiology: An Introduction (13th Edition)
- Fill out the data table attached below with regard to the medically significant bacteria. Attached beside is a sample data table for Staphylococcus aureus. Microorganism/Causative Agent: Salmonella Typhiarrow_forwardFill out the data table attached below with regard to the medically significant bacteria and the diseases it cause. Attached beside is a sample data table for Staphylococcus aureus Microorganism/Causative Agent: Salmonella Typhiarrow_forwardBelow are a list of virulence factors/ strategies paired with an example of an organism that utilizes them. How do each of the following strategies contribute to the virulence of the pathogen? Strategy - Causes the host to produce more receptors (Organism - Rhinovirus) Strategy - Produces gas as a product of fermentation (Organism - Clostridium perfringens) Strategy - Produces a capsule (organism - Klebsiella pneumonia) Strategy - Ability to move between adjacent cells (organism - Cytomegalovirus) Strategy - Ability to use pilus as a motility structure (organism - Pseudomonas aerogenosa)arrow_forward
- go to the website https://www.nature.com/immersive/d42859-019-00041-z/index.html and scroll up and down to review the milestones associated with microbiota research. Answer the questions/ prompts below. Bacteria and our brain? Read the information associated with this milestone and what was discovered. Briefly describe what they found...Milestone/year? What milestone is associated with the debate about when the microbiome is first established? Why is there a debate? Watch the video just below the milestone. What specific type of gene analysis was used to determine that we have our own unique microbiome? Which milestone/year? Sometimes we need antibiotics...this milestone discusses how long it can affect us after infection. In this milestone they discussed how long we could be affected by one course of antibiotics...how long? Which milestone/year? Find the milestone associated with a highly motile bacteria. What disease was treated? How was this treatment used for a…arrow_forwardwrite out a detailed summary on Salmonella. Questions below will help you frame your summary. Please describe the bacterium. What is its shape and size? Is it Gram-positive or negative? Pictures are always fun! If you can find a microscopic image – include it. What is/are the reservoir(s)? e.g. water, food, human, etc. Are there parameters needed for infection? (Temperature, pH) What is/are the mode(s) of transmission. If it's foodborne - is it linked to a specific food? How many cases occur each year? In the US and/or worldwide and/or in the County where you live Has it caused any outbreaks or epidemics? Thank you-arrow_forwardYou grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTarrow_forward
- Two microbiologists are writing a textbook, but they cannot agree where to place the discussion of botulism. One favored the chapter on nervous system infections, whereas the other insisted on the chapter covering digestive system infections. Where do you think the discussion should be placed, and why?arrow_forwardIdentify the genus that best fits each of the following descriptions: a. This organism can produce a fuel used for home heating and for generating electricity. b. This gram-positive genus presents the greatest source of bacterial damage to the beekeeping industry. c. This gram-positive rod is used in dairy fermentations. d. This gammaproteobacterial genus is well suited to degrade hydrocarbons in an oil spill.arrow_forwardcan you explain why Bacillus anthracis can be pathogenic in a mouse and not be fought off by the immune system? I need help finding the answer in the article and explain in short answer link to article: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC106848/arrow_forward
- Propionibacterium acnes is a normal member of the skin microbiome that benefits the body by lowering the skin's pH- an antimicrobial effect. However, P. acnes is also the leading cause of acne. Explain mechanistically how can a bacterium be normal and beneficial but also be pathogenic?arrow_forwardWrite a 1-2 paragraph case study that accurately depicts the disease caused by Clostridium Botulinum. If your organism is transmitted in a specific location or under certain circumstances be sure your patient has been to those locations or engaged in those behaviors that would lead to transmission Have the appropriate timeline in terms of incubation and length of illness. Cover the important symptoms. You do not have to give all possible symptoms, just the typical one. Provide some important laboratory test results without stating the name of your microorganism. Provide the Epidemiology, Pathogenesis, Clinical Manifestations, Laboratory Tests, Treatment and Prevention.arrow_forwardWhat are the common pathogens isolated from stool samples? What is the difference between a coliform bacterium and a noncoliform enteric bacterium? What diagnostic test differentiates Proteus and Providencia species from other Enterobacteriaceae? How would you differentiate between serotypes of E. coli? Are the gram-negative enteric bacilli fastidious organisms? Would they survive well outside of the body? If so, what significance would this have in their transmission? Why is serotyping particularly important in Salmonella infections and typhoid fever?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education