SEELEY'S ANATOMY+PHYSIOLOGY
12th Edition
ISBN: 9781260172195
Author: VanPutte
Publisher: RENT MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 2.4, Problem 55AYP
Summary Introduction
To determine:
The meaning of the given statement “DNA strands are antiparallel.”
Introduction:
Deoxyribonucleic acid (DNA) is known as the genetic material of living cells. DNA contains the genetic information, which gets transmitted from one generation to the next generation of the cells.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
If one DNA strand is 5′–GATTCGTTC–3′, what is the complementary strand?
In a segment of DNA consisting of 1000 nitrogen bases,
28% of which are thymine, how many bases are
adenine, guanine, and cytosine?
In a single strand of DNA, is it ever possible for the number of adenines to be greater than the number of thymines? Describe
Chapter 2 Solutions
SEELEY'S ANATOMY+PHYSIOLOGY
Ch. 2.1 - Define matter. How are the mass and the weight of...Ch. 2.1 - Differentiate between element and atom. What four...Ch. 2.1 - Prob. 3AYPCh. 2.1 - Which subatomic particle determines the atomic...Ch. 2.1 - What is an isotope? How are isotopes denoted?Ch. 2.1 - What is avogardro’s number? How is it related to a...Ch. 2.1 - Describe how an ionic bond is formed. What are...Ch. 2.1 - What occurs in the formation of a covalent bond?...Ch. 2.1 - Distinguish between a molecule and a compund. Give...Ch. 2.1 - What are intermolecular forces, and how do they...
Ch. 2.1 - What is meant by the statement “table sugar is...Ch. 2.1 - Describe what occurs during the dissociation of...Ch. 2.1 - Explain the difference between electrolytes and...Ch. 2.2 - Using the terms reactant and product, describe...Ch. 2.2 - Contrast synthesis and decomposition reactions,...Ch. 2.2 - Describe the role of water in dehydration and...Ch. 2.2 - What is a reversible reaction? How does this type...Ch. 2.2 - What are oxidation-reduction reactions?Ch. 2.2 - Define energy. How are potential and kinetic...Ch. 2.2 - Summarize the characteristics of mechanical,...Ch. 2.2 - Use ATP and ADP to Illustrate the release or input...Ch. 2.2 - Define activation energy, catalyst, and enzymes;...Ch. 2.2 - What effect does increasing temperature or...Ch. 2.3 - What is the difference between inorganic and...Ch. 2.3 - What two properites of water are the result of...Ch. 2.3 - List and briefly describe the four functions that...Ch. 2.3 - Prob. 27AYPCh. 2.3 - Prob. 28AYPCh. 2.3 - Prob. 29AYPCh. 2.3 - Prob. 30AYPCh. 2.3 - Prob. 31AYPCh. 2.3 - Prob. 32AYPCh. 2.3 - Prob. 33AYPCh. 2.3 - Prob. 34AYPCh. 2.3 - What are the functions of oxygen and carbon...Ch. 2.4 - Prob. 36AYPCh. 2.4 - Prob. 37AYPCh. 2.4 - Prob. 38AYPCh. 2.4 - Prob. 39AYPCh. 2.4 - Which carbohydrates are used for energy? What is...Ch. 2.4 - Prob. 41AYPCh. 2.4 - Prob. 42AYPCh. 2.4 - Prob. 43AYPCh. 2.4 - Prob. 44AYPCh. 2.4 - Prob. 45AYPCh. 2.4 - Prob. 46AYPCh. 2.4 - What are the building blocks of proteins? What...Ch. 2.4 - Prob. 48AYPCh. 2.4 - Prob. 49AYPCh. 2.4 - Compare the lock-and-key and the induced fit...Ch. 2.4 - Prob. 51AYPCh. 2.4 - What are the basic building blocks of nucleic...Ch. 2.4 - DNA is like a twisted ladder. What forms the sides...Ch. 2.4 - Prob. 54AYPCh. 2.4 - Prob. 55AYPCh. 2.4 - Prob. 56AYPCh. 2.4 - Prob. 57AYPCh. 2 - Prob. 1RACCh. 2 - Prob. 2RACCh. 2 - Prob. 3RACCh. 2 - Prob. 4RACCh. 2 - Table salt (NaCl) is an atom organic. a molecule....Ch. 2 - Prob. 6RACCh. 2 - Prob. 7RACCh. 2 - Prob. 8RACCh. 2 - Prob. 9RACCh. 2 - Prob. 10RACCh. 2 - Prob. 11RACCh. 2 - Which of these statements concerning enzymes is...Ch. 2 - Prob. 13RACCh. 2 - Prob. 14RACCh. 2 - Prob. 15RACCh. 2 - Prob. 16RACCh. 2 - A buffer slows down chemical reactions. speeds up...Ch. 2 - Prob. 18RACCh. 2 - Prob. 19RACCh. 2 - Prob. 20RACCh. 2 - Prob. 21RACCh. 2 - Prob. 22RACCh. 2 - Prob. 23RACCh. 2 - DNA molecules conatin genes. contain a single...Ch. 2 - Prob. 25RACCh. 2 - Prob. 1CTCh. 2 - Prob. 2CTCh. 2 - A mixture of chemicals is warmed slightly. As a...Ch. 2 - Two solutions, when mixed together at room...Ch. 2 - Prob. 5CTCh. 2 - Prob. 6CTCh. 2 - Carbon dioxide that accumulates in the blood can...Ch. 2 - An enzyme (E) catalyzes the following reaction:...Ch. 2 - Using the materials commonly found in a kitchen,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandarrow_forwardIf the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became A-C-T-G-G-C-C-T-A, what effect would the mutation have on the sequence of the protein produced?arrow_forwardshow the structure for nucleosides of DNA:arrow_forward
- What is the sequence of amino acids coded by the following sequence of nucleotides on a strand of DNA from the 5' to 3' end? A - T - C - G - C - T - A - C - G - A - A - T How many nucleotides are there?arrow_forwardWrite the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAAarrow_forwardHow long (Å) is an alpha helix of 16 amino acid residues?arrow_forward
- If one of the strands of DNA has the following sequence of bases running in the 5-S3' direction,5'-G-G-A-C-A-A-T-C-T-G-C-3' what base is closest to the 5'-end in the complementary strand?arrow_forwardWhat type of DNA helix spirals to the left and the backbone takes on a zigzag shape?arrow_forwardHow many combinations of DNA bases are for a polynucleotide of 7 base pairs in length?arrow_forward
- What are the bonds that hold the backbone of each DNA strand together called?arrow_forwardWhat sequence of bases on one strand of DNA (reading in the 3′ to 5′ direction) is complementary to the sequence 5′ T-A-T-G-C-A-G 3′ on the other strand?arrow_forwardOne DNA chain of a DNA double helix contains 18% A, 35% T, 28% C, and 21% G. What is the composition of the complementary DNA chain?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY