Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Question
Chapter 15, Problem 13QP
Summary Introduction
Introduction: The CFTR (cystic fibrosis) gene is responsible for the production of the cystic fibrosis transmembrane conductance regulator protein. This protein works as a channel across the cell membrane and regulates the transportation of the chloride ions in the cells of an organism.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Given: eukaryotic cells can make different proteins, using only one gene. How can a eukaryotic cell make different final proteins from the same gene? Note: some of the answers are actually correct statements, but they don't have anything to do with this question.
A.Eukaryotes have 3 RNA polymerases instead of just one.
B.Eukaryotes cannot perform simultaneous transcription and translation.
C.Eukaryotes splice RNA and can do so in various arrangements.
D.Eukaryotes lack the Shine Delgarno sequence.
A given coding strand sequence in a Eukaryote is as follows
5'GGGAATATAA GACCGATGGA GGGTACAG CCCTATCAC GATACGCAGG
ATAGCAGCA 3"
a) Mark the promoter in blue and transcribe from the G after the promoter.
b) Translate the mRNA made
c) The mRNA made by the cell was 10 nucleotides shorter than what you have
made. What could have happened?
d) EXTRA practice: A particular triplet of bases in the coding strand of DNA is 5'GAC 3'.
What is the amino acid for this codon and will be the anticodon on the tRNA that binds
the mRNA codon?
Refer to the DNA sequence provided:
3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’
a. What is the mRNA transcript of the anticoding strand of the DNA model?
b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
Chapter 15 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 15.1 - Who Owns Your Genome? John Moore, an engineer...Ch. 15.1 - Who Owns Your Genome? John Moore, an engineer...Ch. 15 - James sees an online ad for an at-home genetic...Ch. 15 - James sees an online ad for an at-home genetic...Ch. 15 - James sees an online ad for an at-home genetic...Ch. 15 - James sees an online ad for an at-home genetic...Ch. 15 - The gene controlling ABO blood type and the gene...Ch. 15 - Hemophilia and color blindness are both recessive...Ch. 15 - Prob. 3QPCh. 15 - Prob. 4QP
Ch. 15 - How many nucleotides does the human genome...Ch. 15 - Which of the following best describes the process...Ch. 15 - Which of the following is NOT an activity carried...Ch. 15 - Prob. 8QPCh. 15 - Prob. 9QPCh. 15 - What percentage of the DNA in the genome actually...Ch. 15 - When the human genome sequence was finally...Ch. 15 - One unexpected result of the sequencing of the...Ch. 15 - Prob. 13QPCh. 15 - Prob. 14QPCh. 15 - Prob. 15QPCh. 15 - Prob. 16QPCh. 15 - Prob. 17QP
Knowledge Booster
Similar questions
- The following results were obtained in early studies on the translation of secretory proteins. Based on what we now know of this process, explain the reason why each result was observed.a. An in vitro translation system consisting only of mRNA and ribosomes resulted in secretory proteins that were larger than the identical protein when translated in a cell.b. A similar system that also included microsomes produced secretory proteins that were identical in size to those found in a cell.c. When the microsomes were added after in vitro translation, the synthesized proteins were again larger than those made in a cell.arrow_forwardGiven the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forwardGive typing answer with explanation and conclusion Which description applies to alternative mRNA splicing? 1. heritable changes in gene expression that occur without altering the DNA sequence 2. processing of exons in mRNA that results in a single gene coding for multiple proteins 3. mRNA modifications such as additions of a 5′‑cap and 3′ poly‑A tail and removal of introns 4. a gene cluster controlled by a single promoter that transcribes to a single mRNA strand 5. protein modifications such as addition of a functional group or structural changes such as folding Answer 2 is correct.arrow_forward
- If mature eukaryotic MRNA is hybridized with its corresponding genomic DNA template strand and visualized by electron microscopy, two types of structures are seen: RNA:DNA double-stranded heteroduplexes and single stranded DNA loop structures, as shown in the diagrams below. What do you think these single stranded DNA loops represent? (a) Micrograph of DNA-RNA hybrid (b) Interpretation of micrograph Single-stranded DNA only Single-stranded DNA base paired with MRNA Select one: а. Exons b. Introns c. 5' UTR d. 3' UTR e. promoterarrow_forwardConsider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forwardConsider this sequence below: GAG TAC ACG AGT GGA Which of the following options is an example of a non-synonymous point mutation? (remember to translate to mRNA!) A. GAG TAC AAT CGA GTG GA B. GAG TAC ACG GGT GGA C. GAG TAC A–G AGT GGA D. GAG TAC ACG AGA GGAarrow_forward
- Sickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…arrow_forwardConsider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?arrow_forwardYou are studying a human cancer cell line and you notice that you see the normal amount of RNA but the protein concentration is extremely low. When you investigate more closely you notice that the MRNA is properly processed and in the cytosol but you detect very little protein. When you sequence the mRNA you see no mutations. a) When you sequence the ribosomal RNA associated with the small subunit you notice two transition mutations. What function of the ribosome might be disrupted by these mutations? b) You also sequence the DNA encoding the large ribosomal subunit and notice one substitution mutation. What function of the ribosome might be disrupted by this mutation? c) Suggest one experiment that you might do to determine if the mutations in (a) or the mutation in (b) is the cause of low protein production.arrow_forward
- A principle function of 5' and 3' end modifications of eukaryotic mRNA is: a. to ensure that all nucleotides are phosphorylated b. to protect RNA from nucleolytic degradation c. to guide the removal of introns d. to serve as binding sites for translation release factorsarrow_forward1)A. how do you read a sequence of DNA (template or non-template strand) to convert it an mRNA sequence and to a protein? B.How does chromatin remodeling regulate gene transcription? C. What are the major differences between gene expression in bacteria and eukaryotes D. How are non-coding regions involved in gene transcription? E. Explain how eukaryotic genes sometimes produce multiple protein products?arrow_forwardQ.) A.)Search in human genome if any examples of mRNA translated from 2 different sites?and give examples? B.)aminoacyl tRNA synthetase is specialized or not ? And why?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning