Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 11PDQ
When a codon in an mRNA with the sequence 5′-UAA-3′ enters the A site of a ribosome, it is not recognized by a tRNA with a complementary anticodon. Why not? What recognizes it instead?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
When a codon in an mRNA with the sequence 5′-UAA-3′ enters the A site of a ribosome, it is not recognized by a tRNA with a complementary anticodon. Why not? What recognizes it instead?
A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.
The peptidyl binding (P) site of the ribosome is always oriented toward the 5’ end of the mRNA while the amino-acyl (A) site or acceptor site is always oriented in the 3’ terminus. Why?
Chapter 14 Solutions
Concepts of Genetics (12th Edition)
Ch. 14 - Prob. 1NSTCh. 14 - A series of mutations in the bacterium Salmonella...Ch. 14 - HbS results from the substitution of valine for...Ch. 14 - Given that a faulty ribosomal protein is the...Ch. 14 - A couple with a child affected with DBA undergoes...Ch. 14 - Prob. 3CSCh. 14 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 14 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 14 - Contrast the roles of tRNA and mRNA during...Ch. 14 - Francis Crick proposed the adaptor hypothesis for...
Ch. 14 - During translation, what molecule bears the codon?...Ch. 14 - The chain of eukaryotic hemoglobin is composed of...Ch. 14 - Assuming that each nucleotide in an mRNA is 0.34...Ch. 14 - Summarize the steps involved in charging tRNAs...Ch. 14 - To carry out its role, each transfer RNA requires...Ch. 14 - What are isoaccepting tRNAs? Assuming that there...Ch. 14 - When a codon in an mRNA with the sequence 5-UAA-3...Ch. 14 - Discuss the potential difficulties of designing a...Ch. 14 - Prob. 13PDQCh. 14 - Prob. 14PDQCh. 14 - The synthesis of flower pigments is known to be...Ch. 14 - The study of biochemical mutants in organisms such...Ch. 14 - Explain why the one-gene: one-enzyme concept is...Ch. 14 - Why is an alteration of electrophoretic mobility...Ch. 14 - Prob. 19PDQCh. 14 - Prob. 20PDQCh. 14 - Prob. 21PDQCh. 14 - Prob. 22PDQCh. 14 - Several amino acid substitutions in the and ...Ch. 14 - Define and compare the four levels of protein...Ch. 14 - What are the two common types of protein secondary...Ch. 14 - How do covalent disulfide bonds, hydrogen bonds...Ch. 14 - Prob. 27PDQCh. 14 - List three different types of posttranslational...Ch. 14 - Prob. 29PDQCh. 14 - How does an enzyme function? Why are enzymes...Ch. 14 - Prob. 31PDQCh. 14 - Three independently assorting genes (A, B, and C)...Ch. 14 - How would the results vary in cross (a) of Problem...Ch. 14 - Deep in a previously unexplored South American...Ch. 14 - Many antibiotics are effective as drugs to fight...Ch. 14 - The flow of genetic information from DNA to...Ch. 14 - Prob. 37ESP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. fivearrow_forwardBelow is a diagram of charged tRNAS in the active site of the ribosome during translation of the MRNA into protein. What would be the codon in the mRNA that base pairs with the anti-codon in the t- RNA charged with Glu (Glutamic acid) ? HINT: Check the genetic code table/chart. X. Ala Arg Cys Gly Met Trp Leu Glu TRNA B TRNA A A 5'-AAC-3' 5'-CUU-3' 5'-GAA-3' 5'-AUG-3'arrow_forwardAn mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon, what is the third amino acid of the translated polypeptide?arrow_forward
- What happens when a stop codon is reached by a ribosome? A termination tRNAter binds to the codon and the growing peptide is transferred to it. When the peptidyl-tRNAter reaches the P site, the ribosome dissociates. A separate peptidyl transferase then releases the protein from tRNAter. A termination tRNAter binds to the codon and the growing peptide is transferred to it. When the peptidyl-tRNAter reaches the P site, the ribosome is signaled to release the protein. The ribosome then is likely to dissociate. A release factor binds to the codon and is used to release the growing peptide from the P site tRNA. A termination tRNAter binds to the codon and is used to release the growing peptide from the P site tRNA. The ribosome then is likely to dissociate.arrow_forwardRefer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codonarrow_forwardAs shown in the following diagram, a pre-mRNA contains seven exons, which are numbered in black, and six introns, which are numbered in green. A splicing repressor binds at the 3′ splice site at the end of intron 4, which is just before exon 5. What exons will be included in the mature mRNA?arrow_forward
- In how many cases in the genetic code would it NOT be possible to know the amino acid specified by a codon if only the first two nucleotides of the codon are known?arrow_forwardIndicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’arrow_forwardGiven the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the stop codon, the untranslated regions and predict the amino acid sequence of the polypeptidarrow_forward
- An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that would be translated from this mRNA.arrow_forwardThe template strand (i.e.: the strand that is transcribed into RNA, which is usually represented “at the bottom”) of a segment of double helical DNA contains the sequence (5′) TCCGCTCCATCG (3′). What is the base sequence of the mRNA that can be transcribed from this strand?arrow_forwardThe amino acid glycine is encoded by four codons: GGA, GGC, GGG, and GGU. Which of the following statements correctly explains this fact? The glycine anticodon contains the sequence CC, but the 5' base of the anticodon can pair nonspecifically with the 3' base of the codon. The glycine anticodon contains the sequence CC, but the 3' base of the anticodon can pair nonspecifically with the 5' base of the codon. Glycine tRNA has four anticodons, and the appropriate anticodon specifically pairs with the correct codon. There are four tRNAs for glycine, each of which has an anticodon that specifically pairs with the correct codon. all of the abovearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY