’ The translated peptide differs when the guanine molecules are substituted by uracil in the m-RNA sequence. Introduction: The mutation can be defined as the alteration in the genome sequences. Mutation can be the result of error in DNA replication , the ultraviolet rays in the sunlight and carcinogens. In the substitution mutations a single nucleotide base pair is substituted by another nucleotide base. These alterations in the nucleotide affect the protein function and structure.

Question

Want to see the full answer?

Answer 1

Question

Chapter 13.3, Problem 1TC

Summary Introduction

To explain:’

The translated peptide differs when the guanine molecules are substituted by uracil in the m-RNA sequence.

Introduction:

The mutation can be defined as the alteration in the genome sequences. Mutation can be the result of error in DNA replication, the ultraviolet rays in the sunlight and carcinogens. In the substitution mutations a single nucleotide base pair is substituted by another nucleotide base. These alterations in the nucleotide affect the protein function and structure.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Date: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger MRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important? 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA (C) 2015 Bethany Lau.

a. Use the genetic code provided in class to predict the sequence of protein formed from the following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA sequence being read shifts rover by a base, and the translation machinery codes, instead, using the nucleotide sequence below, what is the amino acid sequence in the resulting portion of protein? GCUACAUCUUUA c. If a gene mutation results in a point mutation, meaning a single nucleotide is converted to a different nucleotide base, and the translation machinery codes, instead, using the nucleotide sequence below, what is the amino acid sequence in the resulting portion of protein? CGCUCCAUCUUU d. Which mutation is more likely to result in a slightly altered, but still functional, protein, the frame shift mutation or the point mutation? Briefly explain your answer.

(5) AAG a. What is indicated by label (2) in the figure above? b. What is indicated by label (3) in the figure above? c. What is the function of part d. Which amino acid is represented by (6)? e. Give the one anticodon in the 5' to 3' direction that will recognize all the codons for this amino acid in (c).