Biochemistry
9th Edition
ISBN: 9781305961135
Author: Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12, Problem 58RE
Interpretation Introduction
Interpretation:
The statement, “Scientists now believe that AUG is not always the start codon,” is to be explained.
Concept introduction:
The start codon can be explained as the first codon of a messenger mRNA transcript translated by the ribosomes.
Codon is defined as the sequence of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
(recall) During DNA replication one nucleotide strand is used as a template for polymerization of another. What WOULD BE THE NUCLEOTIDE (?) in the newly synthesized complementary DNA chain across
from the nucleotide C
template ATGCAGCTCCAGTCGGTAATG
new strand
O none of answers correct
O Tor A
O A
Chapter 12 Solutions
Biochemistry
Ch. 12 - RECALL Prepare a flow chart showing the stages of...Ch. 12 - Prob. 2RECh. 12 - RECALL Define degenerate code.Ch. 12 - RECALL How can the binding assay technique be used...Ch. 12 - RECALL Which nucleotides break the rules of...Ch. 12 - Prob. 6RECh. 12 - Prob. 7RECh. 12 - REFLECT AND APPLY It is possible for the codons...Ch. 12 - Prob. 9RECh. 12 - Prob. 10RE
Ch. 12 - REFLECT AND APPLY How would protein synthesis be...Ch. 12 - REFLECT AND APPLY Comment on the evolutionary...Ch. 12 - Prob. 13RECh. 12 - Prob. 14RECh. 12 - RECALL What is the role of ATP in amino acid...Ch. 12 - Prob. 16RECh. 12 - Prob. 17RECh. 12 - Prob. 18RECh. 12 - REFLECT AND APPLY A friend tells you that she is...Ch. 12 - Prob. 20RECh. 12 - REFLECT AND APPLY Is amino acid activation...Ch. 12 - Prob. 22RECh. 12 - Prob. 23RECh. 12 - Prob. 24RECh. 12 - RECALL What are the A site and the P site? How are...Ch. 12 - Prob. 26RECh. 12 - RECALL Describe the role of the stop signals in...Ch. 12 - Prob. 28RECh. 12 - RECALL What is the ShineDalgarno sequence? What...Ch. 12 - REFLECT AND APPLY You are studying with a friend...Ch. 12 - REFLECT AND APPLY E. coli has two tRNAs for...Ch. 12 - REFLECT AND APPLY In prokaryotic protein...Ch. 12 - REFLECT AND APPLY Describe the recognition process...Ch. 12 - REFLECT AND APPLY The fidelity of protein...Ch. 12 - REFLECT AND APPLY (a) How many activation cycles...Ch. 12 - REFLECT AND APPLY What is the energy cost per...Ch. 12 - Prob. 37RECh. 12 - Prob. 38RECh. 12 - Prob. 39RECh. 12 - Prob. 40RECh. 12 - Prob. 41RECh. 12 - Prob. 42RECh. 12 - Prob. 43RECh. 12 - Prob. 44RECh. 12 - Prob. 45RECh. 12 - Prob. 46RECh. 12 - Prob. 47RECh. 12 - RECALL What are two major similarities between...Ch. 12 - REFLECT AND APPLY Why do amino acids other than...Ch. 12 - REFLECT AND APPLY Would puromycin be useful for...Ch. 12 - Prob. 51RECh. 12 - Prob. 52RECh. 12 - Prob. 53RECh. 12 - Prob. 54RECh. 12 - Prob. 55RECh. 12 - Prob. 56RECh. 12 - REFLECT AND APPLY The amino acid hydroxyproline is...Ch. 12 - Prob. 58RECh. 12 - Prob. 59RECh. 12 - Prob. 60RECh. 12 - Prob. 61RECh. 12 - Prob. 62RECh. 12 - Prob. 63RECh. 12 - Prob. 64RECh. 12 - Prob. 65RECh. 12 - Prob. 66RECh. 12 - Prob. 67RECh. 12 - Prob. 68RECh. 12 - Prob. 69RECh. 12 - Prob. 70RECh. 12 - Prob. 71RECh. 12 - Prob. 72RECh. 12 - Prob. 73RE
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- RECALL List several ways in which RNA is processed after transcription.arrow_forwardREFLECT AND APPLY A technology called PCR is used for replicating large quantities of DNA in forensic science (Chapter 13). With this technique, DNA is separated by heating with an automated system. Why is information about the DNA sequence needed to use this technique?arrow_forwardREFLECT AND APPLY Your book contains about 2 million characters (letters, spaces, and punctuation marks). If you could type with the accuracy with which the prokaryote E. coli incorporates, proofreads, and repairs bases in replication (about one uncorrected error in 109to1010 bases), how many such books would you have to type before an uncorrected error is permitted? (Assume that the error rate is one in 1010 bases.)arrow_forward
- REFLECT AND APPLY Explain how DNA gyrase works.arrow_forwardREFLECT AND APPLY You are studying with a friend who says that the hydrogen-bonded portions of tRNA play no important role in its function. What is your reply?arrow_forwardRECALL Give the sequence on the opposite strand for ACGTAT, AGATCT, and ATGGTA (all read 53).arrow_forward
- REFLECT AND APPLY Why is a short RNA primer needed for replication?arrow_forwardREFLECT AND APPLY In prokaryotic protein synthesis, N-formylmethionine (fmet) is the first amino acid incorporated, whereas (normal) methionine is incorporated in eukaryotes. The same codon (AUG) serves both. What prevents methionine from being inserted into the beginning and N-formylmethionine in the interior?arrow_forwardREFLECT AND APPLY (a) How many activation cycles are needed for a protein with 150 amino acids? (b) How many initiation cycles are needed for a protein with 150 amino acids? (c) How many elongation cycles are needed for a protein with 150 amino acids? (d) How many termination cycles are needed for a protein with 150 amino acids?arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY