Biochemistry
9th Edition
ISBN: 9781305961135
Author: Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 12, Problem 2RE
Interpretation Introduction
Interpretation:
The reason for the fact that a two base genetic code encoding a single amino acid is not sufficient for the synthesis of proteins is to be explained.
Concept introduction:
Genetic code is a triplet of nucleotides utilized by the cells to interpret the information, which is coded in the genetic material, into the proteins.
The translation of this information is achieved by ribosomes, which bind the amino acids in a sequence specified by the messenger RNA (mRNA), utilizing the transfer RNA (tRNA) to bring the amino acid residues and to read mRNA the three nucleotides at an instant.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
(recall) During DNA replication one nucleotide strand is used as a template for polymerization of another. What WOULD BE THE NUCLEOTIDE (?) in the newly synthesized complementary DNA chain across
from the nucleotide C
template ATGCAGCTCCAGTCGGTAATG
new strand
O none of answers correct
O Tor A
O A
Chapter 12 Solutions
Biochemistry
Ch. 12 - RECALL Prepare a flow chart showing the stages of...Ch. 12 - Prob. 2RECh. 12 - RECALL Define degenerate code.Ch. 12 - RECALL How can the binding assay technique be used...Ch. 12 - RECALL Which nucleotides break the rules of...Ch. 12 - Prob. 6RECh. 12 - Prob. 7RECh. 12 - REFLECT AND APPLY It is possible for the codons...Ch. 12 - Prob. 9RECh. 12 - Prob. 10RE
Ch. 12 - REFLECT AND APPLY How would protein synthesis be...Ch. 12 - REFLECT AND APPLY Comment on the evolutionary...Ch. 12 - Prob. 13RECh. 12 - Prob. 14RECh. 12 - RECALL What is the role of ATP in amino acid...Ch. 12 - Prob. 16RECh. 12 - Prob. 17RECh. 12 - Prob. 18RECh. 12 - REFLECT AND APPLY A friend tells you that she is...Ch. 12 - Prob. 20RECh. 12 - REFLECT AND APPLY Is amino acid activation...Ch. 12 - Prob. 22RECh. 12 - Prob. 23RECh. 12 - Prob. 24RECh. 12 - RECALL What are the A site and the P site? How are...Ch. 12 - Prob. 26RECh. 12 - RECALL Describe the role of the stop signals in...Ch. 12 - Prob. 28RECh. 12 - RECALL What is the ShineDalgarno sequence? What...Ch. 12 - REFLECT AND APPLY You are studying with a friend...Ch. 12 - REFLECT AND APPLY E. coli has two tRNAs for...Ch. 12 - REFLECT AND APPLY In prokaryotic protein...Ch. 12 - REFLECT AND APPLY Describe the recognition process...Ch. 12 - REFLECT AND APPLY The fidelity of protein...Ch. 12 - REFLECT AND APPLY (a) How many activation cycles...Ch. 12 - REFLECT AND APPLY What is the energy cost per...Ch. 12 - Prob. 37RECh. 12 - Prob. 38RECh. 12 - Prob. 39RECh. 12 - Prob. 40RECh. 12 - Prob. 41RECh. 12 - Prob. 42RECh. 12 - Prob. 43RECh. 12 - Prob. 44RECh. 12 - Prob. 45RECh. 12 - Prob. 46RECh. 12 - Prob. 47RECh. 12 - RECALL What are two major similarities between...Ch. 12 - REFLECT AND APPLY Why do amino acids other than...Ch. 12 - REFLECT AND APPLY Would puromycin be useful for...Ch. 12 - Prob. 51RECh. 12 - Prob. 52RECh. 12 - Prob. 53RECh. 12 - Prob. 54RECh. 12 - Prob. 55RECh. 12 - Prob. 56RECh. 12 - REFLECT AND APPLY The amino acid hydroxyproline is...Ch. 12 - Prob. 58RECh. 12 - Prob. 59RECh. 12 - Prob. 60RECh. 12 - Prob. 61RECh. 12 - Prob. 62RECh. 12 - Prob. 63RECh. 12 - Prob. 64RECh. 12 - Prob. 65RECh. 12 - Prob. 66RECh. 12 - Prob. 67RECh. 12 - Prob. 68RECh. 12 - Prob. 69RECh. 12 - Prob. 70RECh. 12 - Prob. 71RECh. 12 - Prob. 72RECh. 12 - Prob. 73RE
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- RECALL Give the sequence on the opposite strand for ACGTAT, AGATCT, and ATGGTA (all read 53).arrow_forwardRECALL List several ways in which RNA is processed after transcription.arrow_forwardREFLECT AND APPLY Your book contains about 2 million characters (letters, spaces, and punctuation marks). If you could type with the accuracy with which the prokaryote E. coli incorporates, proofreads, and repairs bases in replication (about one uncorrected error in 109to1010 bases), how many such books would you have to type before an uncorrected error is permitted? (Assume that the error rate is one in 1010 bases.)arrow_forward
- REFLECT AND APPLY (a) Eukaryotic DNA replication is more complex than prokaryotic replication. Give one reason why this should be so. (b) Why might eukaryotic cells need more kinds of DNA polymerases than bacteria?arrow_forwardRECALL What is the difference between miRNA and siRNA?arrow_forwardREFLECT AND APPLY A technology called PCR is used for replicating large quantities of DNA in forensic science (Chapter 13). With this technique, DNA is separated by heating with an automated system. Why is information about the DNA sequence needed to use this technique?arrow_forward
- REFLECT AND APPLY One of the original structures proposed for DNA had all the phosphate groups positioned at the center of a long fiber. Give a reason why this proposal was rejected.arrow_forwardREFLECT AND APPLY In the MeselsonStahl experiment that established the semiconservative nature of DNA replication, the extraction method produced short fragments of DNA. What sort of results might have been obtained with longer pieces of DNA?arrow_forwardREFLECT AND APPLY You are studying with a friend who says that the hydrogen-bonded portions of tRNA play no important role in its function. What is your reply?arrow_forward
- RECALL What are the key differences between DNA microarrays and protein microarrays, and how they are used in research?arrow_forwardREFLECT AND APPLY E. coli incorporates deoxyribonucleotides into DNA at a rate of 250 to 1000 bases per second. Using the higher value, translate this into typing speed in words per minute. (Assume five characters per word, using the typing analogy from Question 36.)arrow_forwardRECALL What is the name of the process that produces RNA from a DNA template?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY