Suppose you have just determined the DNA base sequence for an especially strong promoter In Escherichia coli and you are Interested in incorporating this sequence into an expression vector. Describe the steps you would use. What precautions are necessary to be sure that this promoter actually works as expected in its new location?

Question

Want to see more full solutions like this?

Answer 1

Textbook Question

Chapter 12, Problem 1AQ

Suppose you have just determined the DNA base sequence for an especially strong promoter In Escherichia coli and you are Interested in incorporating this sequence into an expression vector. Describe the steps you would use. What precautions are necessary to be sure that this promoter actually works as expected in its new location?

Expert Solution & Answer

Summary Introduction

To discuss:

The incorporation of the sequence of a strong promoter in E. coli into an expression vector. Steps and precautions required to evaluate the expression of the promoter in its new location.

Concept introduction:

An expression vector is a plasmid or virus and it used for gene expression. In gene expression, the gene of interest is inserted into the expression vector, which is used to carry the gene to the host. The gene encoding protein is produced in the host organism.

Explanation of Solution

The expression vector is used for high level gene expression of cloned genes (for example, eukaryotic genes) in prokaryotes.
The expression vector should contain an origin of replication, marker gene, and multiple cloning sites.
The promoter sequence must be incorporated into the expression vector.
The expression vector should contain restriction site, where the gene of interest is inserted.
It should help to synthesize the target protein molecule by producing the stable corresponding mRNA molecules. Therefore, strong promoter is required for binding of the RNA polymerase enzyme and that may lead to the high level of transcription.
The promoter should control and regulate the expression of the cloned gene, because more production of foreign protein molecules may disturb the host (E. coli) and it is considered as an important precaution. In addition, this vector should contain the transcription termination region for proper mRNA production. The promoter must contain an operator sequence in its upstream region and that provide RNA polymerase binding on the promoter region.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

Suppose you have just determined the DNA base sequence foran especially strong promoter in Escherichia coli and you areinterested in incorporating this sequence into an expressionvector. Describe the steps you would use. What precautionsare necessary to be sure that this promoter actually works asexpected in its new location?

Recombinant expression in prokaryotic systems has numerous advantages when compared to eukaryotic systems, one of which is the ability to produce the protein of interest at high levels. For this, it is essential to use strong promoters and genetically modified bacteria capable of overexpressing the exogenous gene. Therefore, mark the alternative that best represents the set of bacterial promoters/strains for protein overexpression. * A)use of the T7 promoter, whose induction occurs by the addition of IPTG in the culture medium, and use of the Escherichia coli strain BL21DE3. B)use of the T7 promoter, whose induction occurs by the addition of IPTG in the culture medium, and use of the Escherichia coli DH5 strain. C)use of the lac promoter, whose induction occurs by the addition of IPTG in the culture medium, and use of the Escherichia coli DH5 strain. D) use of the constitutive trp promoter, whose induction occurs by the addition of the amino acid Tryptophan in the medium, and use of…

The sequence of the lac promoter and two mutant promoters (Mutn 1 and Mutn 2) are shown below. The activity of these promoters is measured by fusing the them to the gene for Green Fluorescent Protein (GFP) and measuring the production of green fluorescence by GFP protein. What would you expect the GFP signal to be higher, lower or same for mutant promoters. Mutn 1 (enter higher, lower or same) Mutn 2 (enter higher, lower or same) - 42 ? ? +1 Lac CCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA CCAGGCTTAAAACTTTATGCTTCCGGCTCGTATGTTGTGTGGA Lac Mutl Lac Mut 2 CCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGA

Answer 2

Textbook Question

Chapter 12, Problem 1AQ

Suppose you have just determined the DNA base sequence for an especially strong promoter In Escherichia coli and you are Interested in incorporating this sequence into an expression vector. Describe the steps you would use. What precautions are necessary to be sure that this promoter actually works as expected in its new location?

Expert Solution & Answer

Summary Introduction

To discuss:

The incorporation of the sequence of a strong promoter in E. coli into an expression vector. Steps and precautions required to evaluate the expression of the promoter in its new location.

Concept introduction:

An expression vector is a plasmid or virus and it used for gene expression. In gene expression, the gene of interest is inserted into the expression vector, which is used to carry the gene to the host. The gene encoding protein is produced in the host organism.

Explanation of Solution

The expression vector is used for high level gene expression of cloned genes (for example, eukaryotic genes) in prokaryotes.
The expression vector should contain an origin of replication, marker gene, and multiple cloning sites.
The promoter sequence must be incorporated into the expression vector.
The expression vector should contain restriction site, where the gene of interest is inserted.
It should help to synthesize the target protein molecule by producing the stable corresponding mRNA molecules. Therefore, strong promoter is required for binding of the RNA polymerase enzyme and that may lead to the high level of transcription.
The promoter should control and regulate the expression of the cloned gene, because more production of foreign protein molecules may disturb the host (E. coli) and it is considered as an important precaution. In addition, this vector should contain the transcription termination region for proper mRNA production. The promoter must contain an operator sequence in its upstream region and that provide RNA polymerase binding on the promoter region.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Textbook Question

Chapter 12, Problem 1AQ

Suppose you have just determined the DNA base sequence for an especially strong promoter In Escherichia coli and you are Interested in incorporating this sequence into an expression vector. Describe the steps you would use. What precautions are necessary to be sure that this promoter actually works as expected in its new location?

Expert Solution & Answer

Summary Introduction

To discuss:

The incorporation of the sequence of a strong promoter in E. coli into an expression vector. Steps and precautions required to evaluate the expression of the promoter in its new location.

Concept introduction:

An expression vector is a plasmid or virus and it used for gene expression. In gene expression, the gene of interest is inserted into the expression vector, which is used to carry the gene to the host. The gene encoding protein is produced in the host organism.

Explanation of Solution

The expression vector is used for high level gene expression of cloned genes (for example, eukaryotic genes) in prokaryotes.
The expression vector should contain an origin of replication, marker gene, and multiple cloning sites.
The promoter sequence must be incorporated into the expression vector.
The expression vector should contain restriction site, where the gene of interest is inserted.
It should help to synthesize the target protein molecule by producing the stable corresponding mRNA molecules. Therefore, strong promoter is required for binding of the RNA polymerase enzyme and that may lead to the high level of transcription.
The promoter should control and regulate the expression of the cloned gene, because more production of foreign protein molecules may disturb the host (E. coli) and it is considered as an important precaution. In addition, this vector should contain the transcription termination region for proper mRNA production. The promoter must contain an operator sequence in its upstream region and that provide RNA polymerase binding on the promoter region.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Textbook Question

Chapter 12, Problem 1AQ

Suppose you have just determined the DNA base sequence for an especially strong promoter In Escherichia coli and you are Interested in incorporating this sequence into an expression vector. Describe the steps you would use. What precautions are necessary to be sure that this promoter actually works as expected in its new location?

Expert Solution & Answer

Summary Introduction

To discuss:

The incorporation of the sequence of a strong promoter in E. coli into an expression vector. Steps and precautions required to evaluate the expression of the promoter in its new location.

Concept introduction:

An expression vector is a plasmid or virus and it used for gene expression. In gene expression, the gene of interest is inserted into the expression vector, which is used to carry the gene to the host. The gene encoding protein is produced in the host organism.

Explanation of Solution

The expression vector is used for high level gene expression of cloned genes (for example, eukaryotic genes) in prokaryotes.
The expression vector should contain an origin of replication, marker gene, and multiple cloning sites.
The promoter sequence must be incorporated into the expression vector.
The expression vector should contain restriction site, where the gene of interest is inserted.
It should help to synthesize the target protein molecule by producing the stable corresponding mRNA molecules. Therefore, strong promoter is required for binding of the RNA polymerase enzyme and that may lead to the high level of transcription.
The promoter should control and regulate the expression of the cloned gene, because more production of foreign protein molecules may disturb the host (E. coli) and it is considered as an important precaution. In addition, this vector should contain the transcription termination region for proper mRNA production. The promoter must contain an operator sequence in its upstream region and that provide RNA polymerase binding on the promoter region.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Textbook Question

Answer 6

Textbook Question

Answer 7

Expert Solution & Answer

Summary Introduction

To discuss:

The incorporation of the sequence of a strong promoter in E. coli into an expression vector. Steps and precautions required to evaluate the expression of the promoter in its new location.

Concept introduction:

An expression vector is a plasmid or virus and it used for gene expression. In gene expression, the gene of interest is inserted into the expression vector, which is used to carry the gene to the host. The gene encoding protein is produced in the host organism.

Explanation of Solution

The expression vector is used for high level gene expression of cloned genes (for example, eukaryotic genes) in prokaryotes.
The expression vector should contain an origin of replication, marker gene, and multiple cloning sites.
The promoter sequence must be incorporated into the expression vector.
The expression vector should contain restriction site, where the gene of interest is inserted.
It should help to synthesize the target protein molecule by producing the stable corresponding mRNA molecules. Therefore, strong promoter is required for binding of the RNA polymerase enzyme and that may lead to the high level of transcription.
The promoter should control and regulate the expression of the cloned gene, because more production of foreign protein molecules may disturb the host (E. coli) and it is considered as an important precaution. In addition, this vector should contain the transcription termination region for proper mRNA production. The promoter must contain an operator sequence in its upstream region and that provide RNA polymerase binding on the promoter region.

Answer 8

Expert Solution & Answer

Summary Introduction

To discuss:

The incorporation of the sequence of a strong promoter in E. coli into an expression vector. Steps and precautions required to evaluate the expression of the promoter in its new location.

Concept introduction:

An expression vector is a plasmid or virus and it used for gene expression. In gene expression, the gene of interest is inserted into the expression vector, which is used to carry the gene to the host. The gene encoding protein is produced in the host organism.

Explanation of Solution

The expression vector is used for high level gene expression of cloned genes (for example, eukaryotic genes) in prokaryotes.
The expression vector should contain an origin of replication, marker gene, and multiple cloning sites.
The promoter sequence must be incorporated into the expression vector.
The expression vector should contain restriction site, where the gene of interest is inserted.
It should help to synthesize the target protein molecule by producing the stable corresponding mRNA molecules. Therefore, strong promoter is required for binding of the RNA polymerase enzyme and that may lead to the high level of transcription.
The promoter should control and regulate the expression of the cloned gene, because more production of foreign protein molecules may disturb the host (E. coli) and it is considered as an important precaution. In addition, this vector should contain the transcription termination region for proper mRNA production. The promoter must contain an operator sequence in its upstream region and that provide RNA polymerase binding on the promoter region.

Answer 9

Expert Solution & Answer

Answer 10

Expert Solution & Answer

Answer 11

Summary Introduction

To discuss:

The incorporation of the sequence of a strong promoter in E. coli into an expression vector. Steps and precautions required to evaluate the expression of the promoter in its new location.

Concept introduction:

An expression vector is a plasmid or virus and it used for gene expression. In gene expression, the gene of interest is inserted into the expression vector, which is used to carry the gene to the host. The gene encoding protein is produced in the host organism.

Answer 12

Explanation of Solution

The expression vector is used for high level gene expression of cloned genes (for example, eukaryotic genes) in prokaryotes.
The expression vector should contain an origin of replication, marker gene, and multiple cloning sites.
The promoter sequence must be incorporated into the expression vector.
The expression vector should contain restriction site, where the gene of interest is inserted.
It should help to synthesize the target protein molecule by producing the stable corresponding mRNA molecules. Therefore, strong promoter is required for binding of the RNA polymerase enzyme and that may lead to the high level of transcription.
The promoter should control and regulate the expression of the cloned gene, because more production of foreign protein molecules may disturb the host (E. coli) and it is considered as an important precaution. In addition, this vector should contain the transcription termination region for proper mRNA production. The promoter must contain an operator sequence in its upstream region and that provide RNA polymerase binding on the promoter region.

Answer 13

Ch. 12.1 - Why is a primer needed at each end of the DNA...Ch. 12.1 - How does RT-PCR differ from traditional PCR?Ch. 12.1 - Prob. 3MQ Ch. 12.1 - Describe the basic principles of gene...Ch. 12.2 - What is the purpose of molecular cloning?Ch. 12.2 - Prob. 2MQ Ch. 12.2 - Prob. 3MQ Ch. 12.2 - Prob. 1CR Ch. 12.3 - How can the bacteriophage T7 promoter be used to...Ch. 12.3 - What major advantage does cloning mammalian genes...

Solution Summary: The author explains that an expression vector is a plasmid or virus and it is used for gene expression. It contains an origin of replication, marker gene, and multiple cloning sites.

Videos

Explanation of Solution

Want to see more full solutions like this?

Chapter 12 Solutions