Biology: The Unity and Diversity of Life (MindTap Course List)
14th Edition
ISBN: 9781305073951
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 10, Problem 9SQ
A gene that is knocked out is ________.
- a. deleted
- b. inactivated
- c. expressed
- d. either a or b
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Prokaryotic transcripts are _____________ since several proteins can be produced from one mRNA.
a. polycistronic
b. monocistronic
c. tricistronic
d. bicistronic
8) Which of these describes the function of RNA polymerase?
A. Amplifies the “message" by making multiple copies of an mRNA molecule after it has
been transcribed from DNA
B. Converts a protein sequence to mRNA
The main function of an mRNA molecule is to_______ . a. store heritable information b. carry a translatable message c. form peptide bonds between amino acids
Chapter 10 Solutions
Biology: The Unity and Diversity of Life (MindTap Course List)
Ch. 10 - The expression of a gene may depend on _______. a....Ch. 10 - Prob. 2SQCh. 10 - Binding of ______ to _______ in DNA can increase...Ch. 10 - Prob. 4SQCh. 10 - Prob. 5SQCh. 10 - Muscle cells differ from bone cells because...Ch. 10 - Prob. 7SQCh. 10 - Homeotic gene products _______. a. flank a...Ch. 10 - A gene that is knocked out is ________. a. deleted...Ch. 10 - Which of the following includes all of the others?...
Ch. 10 - Prob. 11SQCh. 10 - Effect of Paternal Grandmothers Food Supply on...Ch. 10 - Prob. 2DAACh. 10 - Effect of Paternal Grandmothers Food Supply on...Ch. 10 - Prob. 12SQCh. 10 - A cell with a Barr body is ___ . a. a bacterium b....Ch. 10 - Operons _____. a. only occur in bacteria b. have...Ch. 10 - Prob. 15SQCh. 10 - Why are some genes expressed and some not?Ch. 10 - Prob. 2CTCh. 10 - Almost all calico cats (one is pictured in FIGURE...Ch. 10 - The photos above show flowers from Arabidopsis...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- During transcription, ___________________. a. A cell divides to make 2 new cells b. A cell divides to make 4 new cells c. DNA is used as a template to create mRNA d. mRNA, rRNA, and tRNA work together to make proteinsarrow_forwardDuring translation, __________________. a. A cell divides to make 2 new cells b. A cell divides to make 4 new cells c. DNA is used as a template to create mRNA d. mRNA, rRNA, and tRNA work together to make proteinsarrow_forwardCertain introns can self-excise from RNA. a. false b. truearrow_forward
- which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forwardRNA splicing removes ________ from the RNA transcript. a. exons b. axons c. intronsarrow_forward_____ is the combination of a seat, elation, another modifications to the histones that allow for changes in DNA winding and unwinding a. Epigentics b. Histone code c. Heterochromatin d. Post translational modificationsarrow_forward
- Epigenetic changes in gene regulation are caused by _ _ _ _ _ _ _ a. missing nucleotides or chromosomes b. modifications to histones and the DNA, but not the nucleotide sequence itself c. mutations of the nucleotide sequencearrow_forwardOperons______ . a. only occur in bacteria b. include multiple genes c. involve selective gene expressionarrow_forwardThe binding of ________ is required for transcription to start. a. a protein b. DNA polymerase c. RNA polymerase d. a transcription factorarrow_forward
- A. Somatic cells are aslo called B. In irder to clone a gene, a gene is inserted into a:arrow_forwardGene expression does not vary by_______ . a. cell type c. stage of development b. extracellular conditions d. the genetic codearrow_forwardThe main function of a DNA molecule is to______ . a. store heritable information b. carry a translatable message c. form peptide bonds between amino acidsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License