Microbiology: An Introduction (13th Edition)
13th Edition
ISBN: 9780134605180
Author: Gerard J. Tortora, Berdell R. Funke, Christine L. Case, Derek Weber, Warner Bair
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 2A
Describe the use of a DNA probe and PCR for:
- a. rapid identification of an unknown bacterium.
- b. determining which of a group of bacteria are most closely related.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Describe how would you determine the following using a real-time PCR instrument.
A) The quantity and quality of a DNA sample.
B) Whether an individual had cystic fibrosis from a genomic DNA sample.
C) If several bacterial pathogens were present in DNA extracted from a food sample.
Recombinant DNA techniques are used to custom –build bacteria for two main reasons: to make a multiple copies of desired genes and to obtain useful proteins. Give an example of each of these applications in the field of pharmaceutical, medicine and agriculture.
describe how the bacteria should have the ability to be recovered back from the infected host for the purpose of experimentation including sequencing ,vitro culturing and polymerase chain reaction amplification.
Chapter 10 Solutions
Microbiology: An Introduction (13th Edition)
Ch. 10 - Which of the following organisms are most closely...Ch. 10 - Here is some additional information on the...Ch. 10 - DRAW IT Use the additional information below to...Ch. 10 - DRAW IT Use the information in the table below to...Ch. 10 - NAME IT Use the key in the Applications of...Ch. 10 - Sergeys Manual of Systematic Bactenoiogy differs...Ch. 10 - Bacillus and Lactobacillus are not in the same...Ch. 10 - Prob. 3MCQCh. 10 - Which of the following is false about scientific...Ch. 10 - You could identify an unknown bacterium by all of...
Ch. 10 - The wall-less mycoplasmas are considered to be...Ch. 10 - Use the following choices to answer questions 7...Ch. 10 - Prob. 8MCQCh. 10 - Prob. 9MCQCh. 10 - Use the following choices to answer questions 9...Ch. 10 - The GC content of Micrococcus is 66-75 moles %,...Ch. 10 - Describe the use of a DNA probe and PCR for: a....Ch. 10 - SF medium is a selective medium, developed in the...Ch. 10 - Prob. 1CAECh. 10 - Prob. 2CAECh. 10 - Prob. 3CAE
Additional Science Textbook Solutions
Find more solutions based on key concepts
Figure 1.18 In the example below, the scientific method is used to solve an everyday problem. Which part in the...
Concepts of Biology
What is the difference between histology and radiography?
Human Anatomy (8th Edition)
Single penny tossed 20 times and counting heads and tails: Probability (prediction): _______/20 heads ________/...
Laboratory Manual for Holes Human Anatomy & Physiology Fetal Pig Version
Why are mutants used as test organisms in the Ames test?
Laboratory Experiments in Microbiology (11th Edition)
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology (6th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Describe what is produced by a PCR assay, how it is detected, and explain how it can determine whether a specific pathogen is present in a sample.arrow_forwardDetermining the genetic profile of a bacterium for its identification is a part of which step of the identification process?arrow_forwardA urine sample has been obtained, and the bacteria in this sample were cultured. To obtain more information regarding the identity of this Gram-negative strain, Sanger sequencing can be used. A bacterial colony is transferred into a 0.2 mL tube containing buffer, then boiled to break open the bacterial cells. The tube is centrifuged, and some of the supernatant is transferred to a PCR tube. Next, the following reagents are added: DNA polymerase, a primer that binds near the 16S rRNA region of the bacterial chromosome, dNTPs, and fluorescently-labeled ddNTPs. The sequencing reaction is processed in a thermocycler, then analyzed by capillary electrophoresis. This experiment generates the following results (in FASTA format): > sequencing results TAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATG TCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATAC CGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTTGCCATCGGA TGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACG…arrow_forward
- Describe the challenges of mono- versus multiplex PCR for detection of bacterial sequences in the environmentarrow_forwardecombinant DNA technology has provided a broad range of tools to help physicians in the diagnosis of diseases. Probes are now used for identification of what infectious agents ?arrow_forwardOrder the following technical steps that are required to identify a bacterium by PCR and sequencing of the 16S rRNA gene. [1 mark] - Carry out thermal cycling (amplification) of the PCR - Checking the PCR product (amplication) by agarose gel electrophoresis - Purify the PCR product - Perform a DNA extraction - Sequence the PCR product(Sanger sequencing) - Grow a fresh overnigh liquid culture - Obtain a pure bacterial culture - Set up a 16S Rrna gene PCR - Perform bioinformatic analysis (BLAST)arrow_forward
- Explain how PCR is used to detect the presence of pathogens in patient samples. Look up an example of where this technique is used routinely in diagnosis.arrow_forward1) Which technique is best suited to determining which genes are activated in a bacterium during infection while causing disease in a person. a) SDS-page b) microarray analysis c) RFLP analysis d) clone library analysis 2)Which of the following is not an application of PCR? a) Determine if two people are related. b) Identify a bacterial pathogen in a patient sample. c) Determine the gene sequence of the gene that codes for a bacterial enterotoxin. d) These are all applications of PCR.arrow_forwardExplain how PCR can be used to detect infectious agents in diagnoses of diseases.arrow_forward
- Explain briefly : (a) PCRarrow_forwardBased on the image below of a Kirby-Bauer assay, this bacteria is most susceptible to which antibiotic? Write the letter of the antibiotic below. G. B. E.arrow_forwardWhy is it important to use a hyperthermophilic DNA polymerase in PCR? a) Because only hyperthermophiles have DNA polymerases. b) Because hyperthermophilic DNA polymerase is able to resist the saline reaction conditions. c) Because hyperthermophilic DNA polymerase is faster than other polymerases. d) Because hyperthermophilic DNA polymerase is able to resist denaturation at 95℃.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License