You overexpressed (asked bacteria to make a lot of) an 80 kDa protein carrying a 6X-His tag and  purified it on a nickel column. You collect frac ons from your purifica on and analyze them using  SDSPAGE. The results are shown in image attached.   a) Interpret the results from the gel. What is wrong? (see image attached) b) Identify 2 possible reasons why this problem is occurring, and for each reason, suggest an  experimental modifica on you can do to troubleshoot.

Select all that apply from the following to each transformation process : The following are White non-glowing colonies White glowing colonies Blue non-glowing colonies Blue glowing colonies None of the above The transformation are: a. LB + kanamycin plates that have been spread with the E. coli cells transformed with your ligations, what phenotype of the colonies do you expect to obtain . b. LB + kanamycin plates that have been spread with the E. coli cells transformed with water, what phenotype of the colonies do you expect to obtain. c. LB plates that have been spread with the E. coli cells transformed with your pHSG298, what phenotype of the colonies do you expect to obtain. d. LB + kanamycin plates that have been spread with the E. coli cells transformed with PHSG298, what phenotype of the colonies do you expect to obtain. e. LB plates that have been spread with the E. coli cells transformed with your ligations, what phenotype of the colonies do you expect to obtain. f. LB plates…

add 9.9mL of sterile medium to give you a Dilution Tube #2. What is the concentration of bacterial cells in Dilution Tube #1 and Dilution Tube #2? 5. ( ts). Here is a hypothetical gene showing the sequence of DNA nucleotides for the template strand (note: the template strand is the strand that is transcribed). This sequence includes the regions that code for start and stop codons in translation as well as introns and exons. The Introns are indicated by UNDERLINED NUCLEOTIDES. Coding Strand of DNA: +1 Box2 (-25) 3' ....TATAAA........ TACTCGATAGCCGAATGTCTTC CTCAGAC TAA... 5' a) Describe the role of the following in transcription of this DNA strand: a. RNA Polymerase b. Promoters c. Transcription factors d. Initiation, elongation and Termination of the pre-mRNA strand b) Transcribe the above DNA into a pre-mRNA Molecule c) You have just transcribed the above molecule of messenger RNA in the nucleus of a human cell. What types of modifications will occur to this RNA before it leaves the…

how does polyacrylamide gel electrophoresis with SDS separate proteins ?