You have the following sequence reads from a genomic clone of the Homo sapiens genome: Read 1: ATGCGATCTGTGAGCCGAGTCTTTA Read 2: AACAAAAATGTTGTTATTTTTATTTCAGATG Read 3: TTCAGATGCGATCTGTGAGCCGAG Read 4: TGTCTGCCATTCTTAAAAACAAAAATGT Read 5: TGTTATTTTTATTTCAGATGCGA Read 6: AACAAAAATGTTGTTATT a. Use these six sequence reads to create a sequence contig of this part of the H. sapiens genome. b. Translate the sequence contig in all possible reading frames. c. Go to the BLAST page of the National Center for Biotechnology Information, or NCBI (http://www.ncbi .nlm.nih.gov/BLAST/, Appendix B) and see if you can identify the gene of which this sequence is a part by using each of the reading frames as a query for protein– protein comparison (BLASTp).

Q: After purifying the expressed protien His6-NEP of interest, the different fractions collected will…

A: SDS-PAGE protein gel showing different fractions collected during purification by immobilized metal…

Q: Club mosses, horsetails, and ferns are_______ plants. a. multicelled aquatic c. seedless vascular b.…

A: Introduction Flowering plants, also known as angiosperms, are plants that produce flowers and…

Q: . Based on Figure 17-4, how many chromatids are in atrivalent?

A: Chromatids are identical copies of replicated DNA that form at the start of cell division. It is…

Q: Using the figure below, answer the following questions Why are locations 2 and 3 important (what…

A: hCG is human chorionic gonadotropin hormone. This hormone is secreted in uterus of female after…

Q: Q.1. Explain the role of pituitary gonadotropins during the follicular and ovulatory phases of the…

A: Introduction In this question we will explain the role of pituitary gonadotropins during the…

Q: What is considered a disadvantage of phenotypic diagnostics compared to genotypic approaches in the…

A: Disadvantage of phenotypic diagnostic over genotypic approaches:-

Q: Compose the characteristics of dandelions or horsetail. (Choose one) 1. Movement 2. Respiration 3.…

A: Taraxacum is a vast genus of flowering plants in the Asteraceae family that includes species that…

Q: nulin is a carbohydrate.  True  False     2. In an unmanaged type 1 diabetic, glucose is present…

A: Insulin assists blood with sugar enter the body's cell so it tends to be utilized for energy.…

Q: What describes a priori protein structure prediction? X: reproduce the interatomic interactions Y:…

A: Protein structure prediction It is used to understand the sequence and structure space of a…

Q: Define phenotypic adaptation. Give one example.

A: Introduction Adaptation:- It is the biological mechanism or physical or behavioral characteristic of…

Q: You are a graduate student working to construct a single gene knockout library of Leptospiria…

A: * That constructed a single gene knockout library of Leptospiria kirschneri one the causative agents…

Q: Review Investigating Life 5.1. What are the sources of radioactive carbon in salamander embryos…

A: researchers incubated salamander eggs in water containing a radioactive carbon isotope; when algae…

Q: Which of the following taste bud is present on the lateral sides of the human tongue?

A: This question is based on the taste buds of the tongue.

Q: MULTIPLE CHOICE Applying strigolactone to a plant will reduce shoot branching. A. True B. False

A: Answer

Q: Compose the characteristics of your own example of an organism (Plant/Animal). 1. Movement 2.…

A: Example- Mimosa pudica.

Q: Q.4. What is foetal ejection reflex? How does it cause parturition?

A: The foetal ejection reflex is a series of mild uterine contractions that occur in response to…

Q: A key result of the pandemic has been the increased scrutiny of scientific research by a broader…

A: Introduction - Despite our public health response to the pandemic's shortcomings, the biomedical…

Q: What are the semiotic of how gays are portrayed in the music video "Sirena" by GLOC-9 and the…

A: Answer ::   The arrangement and relationships of all elements within a shot and the sound of a scene…

Q: 3. A recent study aimed to understand resistance and resilience of winter-active chironomids (lake…

A: Chironomids It belongs to Chironomidaea family, which is a family of nematoceran flies. These flies…

Q: 7. Describe the process of muscle contraction from nerve impulse (start) to relaxation (end).

A: Processes of muscle contraction and relaxation.

Q: How can change in natural resources ripple through asociety?

A: Natural resources are a base for existence of all the living organisms. If natural resources are…

Q: In which way have microbes played a major role in controlling diseases caused by harmful bacteria?

A: Introduction In this question we will discuss about the role of microbes in controlling diseases…

Q: The most acceptable model of the cell membrane is that of, and ---

A: Plasma membrane or also known as cell membrane is the outer membrane found in all the cells that…

Q: Which of the following is a balancing organ in humans? a) Eardrum b) Vestibular region c) Cochlea d)…

A: Introduction - Sense organs are sensory neurons-based organs that assist us in perceiving and…

Q: Starches are more highly branched than glycogen.

A: Starch is a polymeric carbohydrate which consists of large number of glucose units joined by…

Q: What slide preparation technique should you use to determine the chromosome number of a newly…

A: Microtechniques are set of approaches used in preparation of micro-objects for research.  Two…

Q: What are the reasons for the unprecedented increase in life expectancy that occurred in the 20th…

A: Life Expectancy is defined as the average number of years humans can survive. Currently, life…

Q: sen's disease, also kr eria infect the Schwa eripheral nerves to fc ne immune system on causes a…

A: De myleination is common in both Hansen's disease as well as multiple sclerosis. In multiple…

Q: Simpson’s Diversity Index results in a number between 0 and 1. To get a feel for how this equation…

A: Simpson's Diversity Index is a measure of diversity which takes into account the number of species…

Q: Question 8: Among the ecosystem services are control of floods and soil erosion. How is this…

A: Introduction We will answer the question in below step.

Q: Explain any two sexually transmitted diseases and suggest ways to prevent them.

A: The following are some of the advantages of hormonal contraceptives:   This is a method of…

Q: how does a sea shell become the golden ratio?

A: Love and fecundity are typically associated with seashells. The seashell can be seen as a symbol of…

Q: Glucose is an isomer of fructose only galactose only neither galactose nor fructose invert sugar…

A: Biological macromolecules are the molecule that are needed in enough amount for our body and…

Q: 29. [3] Ignoring the seroprevalence rates, suppose a statistical analysis revealed that the QALY…

A: Answer :- Yes, Engerix-B or Recombivax-HB hepatitis B vaccines are interchangeable. However, if…

Q: purple anoxygenic bacteria capable of becoming the very strong oxidant found in P680. Consider both…

A: Purple sulfur bacteria are called anoxygenic as they use sulphur, hydrogen, sulphite, thiosulfate,…

Q: Bacterial generation times for four different bacterial species were calculated in the media listed…

A: The time it takes for a population of bacteria to double in size is known as generation time. The…

Q: During osmosis, there is water moving passively against its own concentration gradient as a result…

A: During osmosis, there is water moving passively against its own concentration gradient as a result…

Q: What is “Waste to Value-Added Product Production” all about and How is it related to utilizing…

A: Food waste is the maximum tough problem humankind is going through global. Food waste, which…

Q: Cell motility is facilitated by the presence of cytoskeletal components called

A: Cells are the fundamental functioning units of all living organisms. The knowledge of cell biology…

Q: n guinea pigs, black hair color (B) is dominant and brown hair color (b) is recessive. Long hair (L)…

A: Zygozygosity can be heterozygous or homozygous. Heterozygous people have one recessive and one…

Q: Q.3. How is it that the embryo sacs of some apomictic species look normal but contain diploid cells?

A: Introduction We will answer the question in below step.

Q: How do the concepts of sex and gender interact?

A: Sex is one's biological identity, either male or female. Gender is the socially learned…

Q: What are the various constituents of domestic sewage? Discuss the effects of sewage discharge on a…

A: Introduction In this question we will discuss about the various constituents of domestic sewage.

Q: human phenotypes

A: Phenotype is defined as an organism's expressed physical traits. Phenotype is determined by an…

Q: Most living organisms cannot survive at temperature above 45°C°. How are some microbes able to live…

A: Introduction We will answer the question in below step.

Q: A site of communication between neurons is called a _________ 2. Where is the cerebral spinal fluid…

A: Neurons are also known as fundamental unit of brain and nervous system. The main function is to…

Q: What is the expected phenotypic ratio in the F1 of cross 6? A) 50% black females, 50% black males B)…

A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…

Q: Facilitated diffusion is a form of active transport.

A: Active transport is the movement of molecules that requires energy. It takes place against the…

Q: Could you please explain the term ʼzoonosis'.

A: Introduction Diseases are an illness or sickness characterized by specific signs or symptoms, it…

Q: 31) Which method of exocrine gland secretion is strictly via exocytosis? A) merocrine B) holocrine…

A: The secretions of exocrine glands are released with the help of a duct while the secretions of…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.