Biochemistry
9th Edition
ISBN: 9781319114671
Author: Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Question
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 2 steps
Knowledge Booster
Similar questions
- You are cloning a gene called ice, which will help strawberry plants survive in cold weather, into a test group of strawberry plants. Select the events you would use to genetically engineer these plants. Insert the ice gene into the T-DNA region of a Ti plasmid; transform Agrobacterium tumefaciens with this plasmid; Inoculate a culture of strawberry plant cells with Agrobacterium tumefaciens; Select plant cells that have taken up the ice gene. Insert the ice gene into the T-DNA region of the Agrobacterium tumefaciens chromosome; Inoculate a culture of strawberry plant cells with Agrobacterium tumefaciens; Select plant cells that have taken up the ice gene. O Insert the ice gene into a Ti transposon; Introduce the transposon into Agrobacterium tumefaciens Ti plasmid: Inoculate a culture of strawberry plant cells with Agrobacterium tumefaciens: Select plant cells that have taken up the ice gene. Insert the ice gene into a Ti bacteriophage; transduce Agrobacterium tumefaciens with this…arrow_forwardIn Figure 5-19, how many different bacterial species areshown as having contributed DNA to the plasmid pk214?arrow_forwardMargaret has been given a plasmid containing her favorite gene, afg (Margaret’s favorite gene). The only thing sheknows is that afg was cloned into the vector using a single restriction enzyme, BstBI. Margaret orders theBstBI enzyme from NEB, so she can cut the plasmid and confirm the presence of the insert. On theNanodrop, she measures the concentration of her plasmid to be 401 ng/μL. Describe how she would setup and perform this reaction if she wanted to digest 2.0 μg of the plasmid.arrow_forward
- A newly discovered insect has a genomic DNA that does not contain any repetitive DNA or any intronic regions. The insect’s genomic DNA has been treated with the restriction enzyme EcoRI. One of the fragments (with a length of 4 kb) produced in this manner is isolated and ligated into a pUC19 plasmid vector that has also been treated with EcoRI. This recombinant construct is called plasmid A. Samples of plasmid A, pUC 19, and the total genomic DNA from the insect are digested completely with the restriction enzyme EcoRI. The three digests are loaded into separate wells: plasmid A (lane 1), pUC19 (lane2) and total insect genomic DNA (lane 3) of an agarose gel and subjected to electrophoresis. 2b. Draw what will be seen in each lane if the gel is transferred to a membrane and subjected to Southern blotting and the 4000 base pair genomic DNA fragment (labeled with a fluorescent tag) from the insect is used to probe the blot.arrow_forwardI’m having trouble finding which answer would be acceptable can you please help?arrow_forwardWhat is the size for cut lane #5 to measure the Sac1? The T-vector size is 3kb, what is the size for the insert?arrow_forward
- An 9 kb circular plasmid is cut with the EcoRI restriction enzyme, and the reaction products are run on a DNA gel and stained with ethidium bromide. Bands of 1, 3 and 5 kb are seen. How many EcoRI sites are in the plasmid? Choose the one answer that is most correct. a) At least 2 b) At least 3 c) At least 1 d) None e) At least 4 f) At least 5arrow_forwardEntire sequence below needs to beamplified by PCR and subcloned into a plasmid vector. Which of the primersequences listed underneath is the correct reverse primer (6 marks)? Copy correctsequence into your answer. Why primer e) is not the right answer (4 marks)? 5'ATCTCTATTTAATATTTATGTCTATTTAAGCCTCATATTTAAAGACAGGGAAGAGCAGAACGGAGCCCCAGGCCTCTGTGTCCTTCCCTGCATTTCTGAGTTTCATTCTCCTGCCTGTAGCAGTGAGAAAAAGCTCCTGTCCTCCCATCCCCTGGACTGGGAGGTAGATAGGTAAATACCAAGTATTTATTACTATGACTGCTCCCCAGCCCTGGCTCTGCAATGGGCACTGGGATGAGCCGCTGTGAGCCCCTGGTCCTGAGGGTCCCCACCTGGGACCCTTGAGAGTATCAGGTCTCCCACGTGGGAGACAAGAAATCCCTGTTTAATATTTAAACAGCAGTGTTCCCCATCTGGGTCCTTGCACCCCTCACTCTGGCCTCAGCCGACTGCACAGCGGCCCCTGCATCCCCTTGGCTGTGAGGCCCCTGGACAAGCAGAGGTGGCCAGAGCTGGGAGGCATGGCCCTGGGGTCCCACGAATTTGCTGGGGAATCTCGTTTTTCTTCTTAAGACTTTTGGGACATGGTTTGACTCCCGAACATCACCGACGCGTCTCCTGCTG 3'a) 5' TTCCGGAAGAAGCTTATACGG 3'b) 5' CTGTGTTCACCTAATATTCCT 3'c) 5' CAGCAGGAGACGCGTCGGTGA 3'd) 5' AGGAATATTAGTATAATCCAC 3'e) 5' GACGCGTCGGTGATGTTCGGG 3’f) 5'…arrow_forwardIn the following "gene library" cloning experiment Digested genomic DNA AmpR gene TCR gene TCR is tetracycline resistant marker, AmpR is ampicillin resistant marker and BamHI is the unique restriction enzyme on plasmid. A PhD student digests/cuts the plasmids with BamHI restriction enzyme and the genomic DNA with EcoRI restriction enzyme. After performing the cloning experiment and obtaining colonies on a selection plate, the obtained cells will be ..... (Hint: this question is even more challenging; the PhD student was later demoted to an MSc student). a) resistant to ampicillin and tetracycline b) sensitive to tetracycline and ampicillin c) resistant to tetracycline and sensitive to ampicillin d) resistant to ampicillin and sensitive to tetracycline e) sensitive to ampicillin and tetracycline BamHIarrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON