Answered: Write a possible mRNA sequence that…

Name: Write a possible mRNA sequence that codes for each peptide. a. Ile–Met
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Write a possible mRNA sequence that codes for each peptide. a. Ile–Met–Lys–Ser–Tyr b. Pro–Gln–Glu–Asp–Phe c. Thr–Ser–Asn–Arg

Science

Biochemistry

Write a possible mRNA sequence that codes for each peptide. a. Ile–Met–Lys–Ser–Tyr b. Pro–Gln–Glu–Asp–Phe c. Thr–Ser–Asn–Arg

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 9RQ: How long would the peptide be that is translated from this MILNA sequence: 5-AUGGGCUACCGA-3? a. 0 b....

See similar textbooks

Similar questions

Write a possible mRNA sequence that codes for each peptide. a. Phe–Phe–Leu–Lys b. Val–Gly–Gln–Asp–Asn c. Arg–His–Ile–Ser
Write a possible mRNA sequence that codes for each of the following peptides. a. Met–Arg–His–Phe c. Gln–Asn–Gly–Ile–Val b. Gly–Ala–Glu–Gln d. Thr–His–Asp–Cys–Trp
A number of fragments that will be formed by cleaving the peptide Met-Ala-Lys-Met-Arg-Phe-Met-Asn by using CNBr is O a. three O b. four O c. five O d. two
What is the correct amino acid sequence for the mRNA code AUGCCAGUAUGA answer choices A. Tyr-Gly-His B. Met-Pro-Val C. Met-Pro-Ala-Val D. Tyr-Gly-Arg-His
If a strand of mRNA is UGC CAU GCC, what is the sequence of amino acids that will be produced? (use the codon chart provided above) a. Met Ile Ser b. Cys His Ala c. Gly Ala Thr d. Tyr Trp Val
The normal sequence of a protein is: Met – Thr – Lys – His – Ser – Ser ... Mutations of the DNA have led to the following protein sequences. In each case, provide a specific explanation of the mutation or mutations that could have occurred. a. Met – Pro – Lys – His – Ser – Ser ... b. Met – Thr c. Met – Thr – Lys – Gln – Leu – Phe ...
a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of impact will this mutation have on the functionality of the protein? Second Letter UAU Tyr UAC UUU UCU UGU UGC Phe Cys C UUC UUA UUG UCC UCA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G Leu UCG CGU CAU His CCU C CCA G CUU CUC CAC CGC Leu CUA Arg Pro CGA CGG CAA Gin CUG CAG AUU AUC lle AUA AUG Met ACG ACU ACC ACA AAU Asn AAC The AAA AGU AGC Ser AGA AAG Lya AGG Arg GCU GCC GUU GAU GAC GAA GAG GGU GGC Gly Asp GUC Val GUA Ala GCA GCG GGA Glu GGG GUG ACC T C A G. G. 6. G G A C T. T. G. Original DNA strand G T A G. G. T. G. G. GA CT T. G. Mutated DNA strand First letter Third letter
The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
How long would the peptide be that is translated from this MILNA sequence: 5-AUGGGCUACCGA-3? a. 0 b. 2 c. 3 d. 4
Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG
4a) Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence: 5'AUGCGACCUAGCUAUGGA3'
1. Below is a sequence of mRNA. Use it to answer the questions below. 5' – AACUCCAUGCUUAUUGCUGGCUGAAAUCGACG-3' How many amino acids will be present in the protein? Write the order of the amino acids in this protein. а. b.