If a strand of mRNA is UGC CAU GCC, what is the sequence of amino acids that will be produced?  (use the codon chart provided above)  a. Met Ile Ser b. Cys His Ala c. Gly Ala Thr d. Tyr Trp Val

Q: e? A)A gene's promoter sequence is transcribed into mRNA. B)Translation begins at the 5′ end of a…

A: Transcription is the process of formation of mRNA from the DNA.and Translation is the process of…

Q: Sequence of nucleotides in MRNA|AUGCGUUCAUGGACU Sequence of amino acids in protein

A: Sequence of nucleotide in mRNA  AUGCGUUCAUGGACU is given .

Q: Which amino acids are coded for by the mRNA strand: AUG UCA CGA GGU? methionine, leucine, alanine,…

A: DNA is the genetic material present within the nucleus in the cell. It maintains the heredity of the…

Q: The function of RNA polymerase is to A) catalyze the formation of phosphodiester bonds between…

A: Gene expression is the process thorough which the DNA directs to form proteins. It involves two…

Q: The Kozak rules determine a. the choice of the start codon in complex eukaryotes. b. the choice of…

A: Eukaryotic mRNA (messenger ribonucleic acid) can have multiple AUG (start codon) sequences on it.…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

A:

Q: Spliceosomes play central roles in .. a) removal of exons from pre-mRNA b) removal of introns from…

A: The mRNA transcribed from the DNA is heterogeneous mRNa or pre mRna which is not the final product.…

Q: Name X and state how it functions in a protein synthesis.  e) Give three differences between…

A: There are two strands which are anti parallel to each other which means they have opposite polarity,…

Q: Contains deoxyribose instead of ribose. O messenger RNA O DNA O transfer RNA

A: Nucleic acids contain the genetic information needed for functioning of cell. These are of two types…

Q: Which of the following best describes mRNA? Group of answer choices a) Complexes with ribosomal…

A: RNAs are produced as a result of transcription process.

Q: The dna is CAT CCA ACC ATA CCC CTA TAC CCA TAT CCT CCC ATT AAA CCG what is the mRNA and A.A.?

A: Thank you for the question Answer :- The process of conversion of DNA to mRNA is called as…

Q: 44

A: The given structure is of tRNA molecule which is an adapter molecules for amino acid synthesis.

Q: Use the table of the codons to answer the following question. Starting with the start codon, what is…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a…

Q: What is the anti-codon in tRNA that corresponds to the codon pGpCpA in MRNA? А. рТрGpC В. рСpGpT С.…

A: During replication and transcription a nucleic acid was copied from another nucleic acid. Hence this…

Q: Predict the sequence of amino acid coded by the mrna sequence 5’ GGA-GGC-ACA-UGG- GAA 3’

A: mRNA is read in 5' to 3' direction. Codons are triplet i.e. a combination of three bases codes for…

Q: What does the amino acid attach to in the tRNA? CAA tail O ACC tail CCA tail AACtail

A: Translation is the process of protein synthesis. It takes place in the cytoplasm.

Q: The ribosome is needed for translation of mRNA (a) because it has the enzyme that forms peptide…

A: Ribosomes are found on Rough endoplasmic reticulum of a cell (in eukaryotes) , which actively…

Q: 2 1] Amino acids are joined fogether into a protein chain by wfrnich of the following a transfer RNA…

A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…

Q: The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome:…

A:

Q: Predict the sequence of amino acids coded by the mRNA sequence 5’ GGA–GGC–ACA–UGG–GAA 3’

A: The single strand of the RNA molecule, which consists of a gene sequence and carries the message…

Q: A portion of an mRNA molecule that determines one amino acid in apolypeptide chain is called a(n)a.…

A: Protein is synthesized from mRNA. Proteins are polymer of amino acid. 20 different amino acids are…

Q: What type of RNA carries and transfers amino acids fromthe cytoplasm to the ribosome for placement…

A: The processes of Replication, Transcription, and Translation form the three aspects of the Central…

Q: a. Identify the following elements on the diagram. Aminoacyl site (A) Peptidyl site (P) Exit site…

A: During translation, a ribosome contains 3 different RNA binding sites:  A site is an aminoacyl or…

Q: Which of the following statements about mRNA is INCORRECT? A. the sugar moiety of mRNA is D-ribose…

A:

Q: . Which may be or is an RNA molecule AGCCTAC GGGCCCA GCCCUUA A & B B & C

A: Nucleic acids like RNA and DNA are made up of nucleotides namely Adenine, Thymine, Guanosine,…

Q: An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start…

A: RNA (Ribo Nucleic Acid) is the genetic material found in prokaryotes and eukaryotes. It is the prime…

Q: The anticodon of a particular tRNA molecule is(A) complementary to the corresponding mRNA codon.(B)…

A: The heart of protein synthesis is the translation of nucleotide sequence information in the form of…

Q: Which of the following amino acid changes could result from a mutation that changed a single base?…

A: Amino acids are the structural units of proteins. They are involved in several metabolic pathways by…

Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…

A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…

Q: If a strand of DNA is GAG  CGT  CTA, what is the sequence of amino acids that will be produced?…

A: A codon is a nucleotide sequence that occurs in triplets (AUG) and each codon codes for a specific…

Q: The ribosome is needed for translation of mRNA

A: Protein synthesis is a fundamental molecular phenomenon that takes place in the cytosol. It occurs…

Q: Identify a protein that can contain a temperature-sensitive mutation that would explain these…

A: The mutation is the change in the nucleotide sequence that can be due to some chemical mutagens or…

Q: The amino acid pool used in translation is found in: a. the cytosol b. in the Golgi apparatus c. in…

A: The amino acid pool used in translation.

Q: A release factor is referred to as a “molecular mimic” because its structure is similar to a. a…

A: Translation is a process of translating the sequence of messenger RNA molecule to amino acid…

Q: Which mRNA would be made if the sequence of the DNA coding strand is GAC? O GAC O GTC O GUC O CUG

A: Amino acids are organic compounds with amino and carboxyl functional groups as well as a side chain…

Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…

A: Introduction According to Chargaff's rules, DNA from any cell of any organism should have a 1:1…

Q: how does the E.coli ribosome find the RNA to be translated? A. the sigma factor B. the shine-…

A: SHINE DALGARNO SEQUENCE The ribosome binds to the ribosomal binding site present on messenger RNA in…

Q: In a polyribosome, the polypeptides associated with which ribosomes will be the longest? a. Those at…

A: Ribosomes are involved in translation by building proteins from amino acids using messenger RNA as a…

Q: _______is/are removed from a new mRNA. a. Introns c. A poly-A tail b. Exons d. Amino acids

A: Nucleic acids are macromolecules. These are of two types - Deoxyribonucleic acid (DNA) and…

Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…

A: The central dogma describes the flow of genetic information. It states that genetic information in…

Q: The job of tRNA is to O A. bring amino acids to the ribosome by matching their anticodon to the…

A: The genetic material is used to store the genetic information in the mitochondria or nuclei of an…

Q: If a sequence of mRNA is CUG AGU GCA, which of the following is the DNA segment from which it was…

A: DNA sequencing is defined as the way of determining the sequence of nucleic acid by identifying the…

Q: Match the type of RNA with it's function A. Creates the Ribosome, or work table to pull amino acids…

A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in coding,…

Q: d. Which amino acid is represented by (6)? e. Give the one anticodon in the 5' to 3' direction that…

A: In this question, we are shown the process of protein formation from a DNA sequence. This takes…

Q: triplet of bases on an mRNA molecule is known as a(n)

A: A triplet of bases on an mRNA molecule is known as a(n) Answer: c)  codon.

Q: The code on a DNA strand reads G C G T A A T G A. The mRNA strand would read:

A: Given: The code on a DNA strand reads GCGTAATGA.

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.