DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH

Give only typing answer with explanation and conclusion

DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG−OH Match the items in the left column to the appropriate blanks in the sentence on the right.

Can you help find the true statement of this problem?

Even though the eukaryotic genome is thousands of times larger than the prokaryotic genome, DNA replication times are relatively similar. Explain how this is possible.

Assume complete digestion of a single linear piece of DNA digested (cut) with EcoRI and Hindill. Assume complete digestion of the plasmid digested with Eco and HindIll. What comes out of the plasmid when you digest with EcoRl and Hindill? What could ligate into the plasmid during ligation! Need help answering these questions

Provide the sequences of the template and coding strands of a DNA double helix that was used to produce this RNA: 5'-AUUACGGUCUAU. Be sure to label the 5' and 3' ends.

A solution containing single stranded DNA with the sequence 5’ATGGTGCACCTGACTCCTGAGGAGAAGTCTNNNNN’3 undergoes DNA replication in vitro in the presence of all four nucleotides plus an amount of dideoxyadenosine triphosphate sufficient to compete for incorporation with deoxyadenosine triphosphate.   How many and what DNA fragments are expected?

Which of the following statement(s) is/are false/incorrect? You may select multiple options, if necessary. ☐ Experiments support bidirectional movement of multiple replication forks at eukaryotic chromosomes. O Mg++ ions play important roles during DNA synthesis Synthesis of DNA is semi-conservative ✔ Beta clamp reduces DNA polymerase processivity ✔ DNA polymerase III uses ATP as a source of energy to drive the polymerization reaction forward O Tautomers enhance chances of correct nucleotide incorporation during DNA synthesis

The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above