Why do transcriptional regulators act as dimers or heterodimers rather than monomers when binding to DNA and regulating genes? O A. The dimer will interact wtih a greater number of nucleotides compared to the monomer allowing for more specificity when interacting with DNA and decreasing the chances of encountering the correct sequence of nucleotides at a random position within the DNA molecule. O B. Forming heterodimers means a smaller number of distinct genes can be regulated by a set number of transcriptional regulators. O C. Dimers or heterodimers are required to be able to fit within the minor groove of the DNA helix. O D. All of the above.

Why do transcriptional regulators act as dimers or heterodimers rather than monomers when binding to DNA and regulating genes? O A. The dimer will interact wtih a greater number of nucleotides compared to the monomer allowing for more specificity when interacting with DNA and decreasing the chances of encountering the correct sequence of nucleotides at a random position within the DNA molecule. O B. Forming heterodimers means a smaller number of distinct genes can be regulated by a set number of transcriptional regulators. O C. Dimers or heterodimers are required to be able to fit within the minor groove of the DNA helix. O D. All of the above.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 21QP: Transcriptional regulators are proteins that bind to promoters (the 5-flanking regions of genes) to...

See similar textbooks

Similar questions

1. Certain proteins that stimulate expression of a gene bind to DNA in a sequence specific manner and also induce conformational changes in the DNA. Describe the purpose of thses two modes of interaction with the DNA. 2. Draw the structures of the amino acid side chains that correspond to the following histone modification: a) acetylation of lysine; b) phosphorylation of serine; c) phosphorylation of histidine. How do thses modifications change the character of their respective side chain?
1. (a) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to sup- press synthesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix - reverse turn - helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein. A diagram of the trp repressor dimer is also shown. Trp Prl Trp Prl 80 -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly-Ile- -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr-Val- trp helix 5 70 trp helix 4 Prl helix 80 Prl helix Ala-Thr-Ile-Thr-Arg-Gly-Ser-Asn-Ser-Leu-Lys-Ala-Ala- Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- reverse turn 90 Comparing the two protein sequences above, identify all amino acid pairs that differ in electrostatic charge due to proton dissociable groups (assume pH 7). Indicate the charge of both residues for each such pair. (b) Circle the pair of residues for which the electrostatic charge due to…
Predict the state of transcription activation in the following scenarios: A. Regulated as usual B. Higher levels of transcription C. Lower levers of transcription Everything in the system is intact except activators can no longer bind to chromatin modifiers Everything in the system is intact except there are overly active histone deacetylases Everything in the system is intact except heterochromatin is constantly shifted to the form of euchromatin Everything in the system is intact except the main coactivator Mediator no longer binds to RNA Polymerase II
(c) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to suppress syn- thesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix – (reverse) turn – helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein, a different type of repressor protein. A diagram of the trp repressor dimer is also shown. reverse turn trp helix 4 70 Trp -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly- Ile- Prl -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr- Val- Pri heilix trp helix 5 80 90 Trp Ala-Thr-Ile-Thr-Arg-Gly-Ser sgn-Ser-Leu-Lys-Ala-Ala- Prl Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- Prl helix
a. Very few if any eukaryotic genes contain tractswith more than 25 As or Ts in a row, yet almost alleukaryotic mRNAs have a tract with more than100 As in a row. How is this possible?b. Scientists know the nucleotide sequences that directthe termination of bacterial gene transcription, butthey generally have little idea about the nature ofthe nucleotide sequences that direct transcriptiontermination in eukaryotic cells. Explain the basisof this statement.
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
At least one nonsense suppressing tRNA is knownthat can suppress more than one type of nonsensecodon.a. What is the anticodon of such a suppressing tRNA?b. What stop codons would it suppress?c. Could this tRNA possibly also function as a missense suppressor?d. What are the amino acids most likely to be carriedby this suppressing tRNA?
a. How do bacteria increase the efficiency of gene expression? Is this possible in eukaryotes? b. A mutation in the promoter of Gene K disrupts an enzyme binding site and results in the loss of Gene K expression. Is this change in gene expression likely happening at the transcriptional or the translational level? Explain. c. Propose three different mutations to prevent initiation, elongation, and termination of bacterial transcription, respectively. Explain how/why each mutation would prevent its respective step. (Hint: mutations can be in genes that encode proteins or regulatory DNA sequences)
1. enzymes that catalyze histone acetlation are closesly associated with transription factors, which are proteins that promote transcription. why is this a good biochemical strategy? 2. sp1 is a sqeuence specific human DNA binding protein that binds to a region on the DNA called the GC box, a promoter element with the sequence GGGCGG. Binding of Sp1 to the GC box enhances RNA polymerase 2 activity 50- to a 100 fold. How would you use affinity chromatography to purify SP1?
Transcriptional regulators are proteins that bind to promoters (the 5-flanking regions of genes) to regulate their transcription. Assume that a particular transcription regulator normally promotes transcription of gene X, a transport protein. If a mutation makes this regulator gene nonfunctional, would the resulting phenotype be similar to a mutation in gene X itself? Why or why not?
A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT Group of answer choices 1.The mutation would inhibit the promoter thereby inhibiting transcription 2.No change the consensus TATAAT sequence in the same. 3.The mutation would move the promoter away from consensus and reduce the level of transcription 4.The mutation would bind the promoter to the consensus and produce normal levels of transcription
5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…