Consider a mutation in -10 BOX promoter consensus sequence (TATAAT) in the prokaryote recA gene where the first T base mutated to G, what outcome(s) are likely? a. transcription levels will increase as the GC content would increase b. this mutation is silent, so no change in transcription level c. transcription levels would decrease because the promoter would be weaker d. transcription levels do not depend on the promoter sequence for the gal gene e.

Consider a mutation in -10 BOX promoter consensus sequence (TATAAT) in the prokaryote recA gene where the first T base mutated to G, what outcome(s) are likely? a. transcription levels will increase as the GC content would increase b. this mutation is silent, so no change in transcription level c. transcription levels would decrease because the promoter would be weaker d. transcription levels do not depend on the promoter sequence for the gal gene e.

Name: Consider a mutation in -10 BOX promoter consensus sequence (TATAAT) in
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Consider a mutation in -10 BOX promoter consensus sequence (TATAAT) in the prokaryote recA gene where the first T base mutated to G, what outcome(s) are likely? a.transcription levels will increase as the GC content would increaseb.this mutation is s

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 21QP: Transcriptional regulators are proteins that bind to promoters (the 5-flanking regions of genes) to...

See similar textbooks

Similar questions

Mutations in bacterial promoters may increase or decrease therate of gene transcription. Promoter mutations that increasetranscription are termed up-promoter mutations, and those thatdecrease transcription are termed down-promoter mutations.The sequence of the −10 site of the promoter for the lac operonis TATGTT (see Figure 14.5). Would you expect each of thefollowing mutations to be an up-promoter or down-promotermutation?A. TATGTT to TATATTB. TATGTT to TTTGTTC. TATGTT to TATGAT
A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT 1.The mutation would move the promoter away from consensus and reduce the level of transcription 2.No change the consensus TATAAT sequence in the same. 3.The mutation would bind the promoter to the consensus and produce normal levels of transcription 4.The mutation would inhibit the promoter thereby inhibiting transcription
A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT Group of answer choices 1.The mutation would inhibit the promoter thereby inhibiting transcription 2.No change the consensus TATAAT sequence in the same. 3.The mutation would move the promoter away from consensus and reduce the level of transcription 4.The mutation would bind the promoter to the consensus and produce normal levels of transcription
67RNA interference was first discovered in Drosophila melanogaster. Yesorno 68Which of the following is required for the bacterial ribosome complex to disassemble?A.EF1A-GTPb.Signal sequencec.Release factorD.EF1B 69A transcription unit must have an initiation signal called a _____________ for accurate and efficient transcription to take place. A.transcription start siteb.promoterc.transcription initiation factorD.ori
Give one example of a prokaryotic system of gene expression that is more complicated (duringtranscription at the promoter) than its corresponding eukaryotic system of gene expression.A. prokaryotes require general transcription factors to initiate transcriptionB. prokaryotes typically have activator and repressor DNA sequences thousands of nucleotides awayC. prokaryotes have three classes of RNA polymerasesD. prokaryotes always have their DNA tightly packed into higher-level structures than nucleosomesE. prokaryotes usually have polycistronic mRNA
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
The promoter consensus sequence at the -10 BOX in the bio gene in E. coli was TAGACT; however, a transversion occurred which changed the G nucleotide to T, what outcome(s) are likely? a. transcription levels would decrease because the promoter would be weaker b. nothing would happen because the promoter would not change the mRNA sequence c. the mutation would block RNA polymerase from binding to the DNA d. transcription levels would increase because the promoter would be stronger e. the bio gene does not require a functional promoter
There is Hyaluronic acid synthesis occuring in Group X Strep and it is controlled by an operon with 3 genes, called hasXYZ. Based on the 3-line diagram model, a. How many ribosome binding sites are there for the protein? b. How many promoters are there for the genes? c. How many start codons are there for the protein? d. How many RNA Polymerase binding locations are there for the genes? e. How many proteins will be fully functional? f. How many mRNA strands are made?
a. How do bacteria increase the efficiency of gene expression? Is this possible in eukaryotes? b. A mutation in the promoter of Gene K disrupts an enzyme binding site and results in the loss of Gene K expression. Is this change in gene expression likely happening at the transcriptional or the translational level? Explain. c. Propose three different mutations to prevent initiation, elongation, and termination of bacterial transcription, respectively. Explain how/why each mutation would prevent its respective step. (Hint: mutations can be in genes that encode proteins or regulatory DNA sequences)
a. The original constitutive operator mutations in thelac operon were all base changes in o1. Why doyou think mutations in o2 or o3 were not isolated inthese screens?b. Explain how a mutagen that causes small insertions could produce an ocmutation.c. Would a strain with one of the ocmutations described in part (b) and also a lacIS mutation be ableto make β-galactosidase either in the presence orabsence of inducer? Explain
A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT O The mutation would bind the promoter to the consensus and produce normal levels of transcription O The mutation would inhibit the promoter thereby inhibiting transcription The mutation would move the promoter away from consensus and reduce the level of transcription O No change the consensus TATAAT sequence in the same. D00 F3 F4 F5 F6 F7 F8 F9 % & 5 6 7 8 9 %24
Comparing the -10 regions of two E. coli promoters which have identical -35 regions revealed the sequence TATAAT for the first and GATACT for the second one. Why does the first promoter cause a higher transcription rate than the second one? a. The transcription rate from the first promoter will be higher, because RNA polymerase will bind TATAAT with a higher affinity than GATACT. b. It will be higher, because formation of the open promoter complex is more easily achieved with TATAAT than with GATACT. c. It will be higher, because TATAAT of the -10 region is transcribed into UAUAAU, which forms fewer hydrogen bonds with the template strand than GAUACU. d. a and b, but not c e. a, b, and c