Answered: Which of the following sequences is…

Which of the following sequences is most likely to form an unstructured loop in a protein structure? A. GPGGGGGPGGG B. VEELLSKVKQLADA C. KVDFHVNDVEVKMH

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: Consider a peptide AKCVSEAALRIKQEANSL. Which of the following secondary structures the peptide can…

A: In the light of proteins, secondary structure refers to the regional spatial organization of the…

Q: GCA UGC CGA UAC

A: 1. The tRNA anticodons for the amino acid sequence shown above is - GCA UGC CGA UAC

Q: Chaperones are: please explain the answer a.proteins that promote proper amino acid incorporation…

A: Proteins are a class of complex nitrogenous organic compounds, composed of amino acid residues…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: For each of the following mRNA sequences predict the appropriate protein sequence: a.…

A: Genetic code refers to the instructions contained in a gene that instructs a cell how to make a…

Q: A solution of peptide of unknown sequence was divided into 2 samples. One sample was tre with…

A: Site specific proteases are enzymes that cleaves polypeptide chains only at specific sites i.e. at…

Q: Below is a sequence of mRNA. Use it to answer the questions below. 5' -…

A: The central dogma in both prokaryotic and eukaryotic cell consists of a series of steps including…

Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…

A: Mutation - Mutation is defined as the sudden inheritable changes in the structure of the DNA or in…

Q: A small section of a gene for a protein has the following nucleotide sequence: CCT AAG GAT TCA CTT…

A: Introduction A mutation is a change in the DNA sequence that may occur due to incorrect…

Q: Define the following terms:a. Rieske proteinb. Psa dimerc. D1/D2 dimerd. A0e. A1

A: The biological system can be defined as a system or the group of entities, organs that will work…

Q: Which of the following sequences is most likely to form an a helix?

A: An alpha helix is a sort of secondary structure, which describes how a protein's main chain is…

Q: They are related in str They have identical ba C) they are the result of a

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: Label the N-terminal and the C-terminal in the above peptide.

A: The amino acid residue on one end of a peptide molecule does have an amine group on the alpha…

Q: Some events that take place in proteins synthesis are shown below: A. peptide bonds are formed B. a…

A: Protein synthesis involves transcription and translation. Transcription involves three steps…

Q: A small section of bacterial enzyme has the amino acid sequence threonine, valine, glycine, and…

A: The process of formation of amino acids from the mRNA sequence is known as translation. mRNA…

Q: Shown below is a portion of primary sequence of a very large protein.…

A: The protein's overall structure contains both alpha helices and beta sheets. The folding and…

Q: Scientists are interested in studying a toxic molecule found in a patient having a viral disease.…

A: Proteins are made up of substances called amino acids. Proteins and amino acids are the components…

Q: Below is the primary sequence of a viral protein.…

A: The charge of a protein is determined by the charge of individual amino acids. The charge of…

Q: A small section of a gene for a protein has the following nucleotide sequence: CTA TCC CCT ACG TCA…

A: A genetic mutation occurs after the formation of the DNA sequence has been altered. Some mutations…

Q: Which of the following could be the DNA template for the following protein primary structum…

A: The DNA is transcribed to produce the mRNA which gets translated into protein. Proteins are polymers…

Q: Define the following terms:a. protein motifb. conjugated proteinc. dyneind. zwitterione.…

A: Introduction: Proteins are major biomolecules that consist of long chains of amino acids. The…

Q: A small section of a gene for a protein has the following nucleotide sequence: GCT AGC AAC CGC GGG…

A: A silent mutation is when a single base set gets swapped out on the DNA, but the mutated RNA…

Q: Consider a protein with the following amino acid sequence: -R-V-G-M-A-E-I-Q–V–L-K-F-V-I-H–L- Which…

A: The 2° (secondary) structure of the peptide chains can be determined using the Chou-Fasman algorithm…

Q: A portion of an unknown enzyme has the amino acid sequence serine – phenylalanine – glutamate –…

A: In Central dogma, DNA is converted into RNA through the process of transcription and RNA is…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: When answering the questions below, please use the ONE-LETTER CODE for the amino acid, with NO…

A: The determination of primary structure of a protein is crucial since the sequence of the protein…

Q: Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic…

A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…

Q: Given Sequence: 5’ – TCAGGACTGATAGGCTAATCGGCCCGCGCACAT-3’ a. Complementary Strand b. Direct…

A: The translation can be defined as a process in which the synthesis of protein from the mRNA occurs.…

Q: describe a mutation that does not alter the amino acid sequence of a protein

A: introduction A mutation is a change in a DNA sequence. Mutations can result from DNA copying…

Q: secondary structure? O -KPGHP- O-KRKKK- -YFVWT- O-MRLEK-

A: Beta sheets are secondary structures of a protein that are formed due to interchain hydrogen bonding…

Q: Define the following terms:a. aldimineb. heat shock proteinc. multifunction proteind. protein…

A: Proteins are the biomolecules and are essential parts of organisms and participate in virtually…

Q: How many PAM sequences are present in the sequence below?…

A: Protospacer adjacent motif(PAM) sequence It is a short DNA sequence(usually 2-6 base pairs in…

Q: In an attempt to understand whether viruses rely on proteins or nucleic acids to transmit their…

A: The present knowledge of DNA's function in heredity has resulted in a wide range of practical uses,…

Q: Write the codons for the following amino acids. 1. Phe 2. Val

A: Genetic codon: - It is the 3 nucleotide sequence of DNA and RNA, all bases are involved in formation…

Q: RNA is composed of single strand polynucleotide polymer. Explore the structure of RNA further. RNA…

A: Ribose is a sugar that serves as the structural basis for ribonucleic acid (RNA), a crucial…

Q: A number of fragments that will be formed by cleaving the peptide Met-Ala-Lys-Met-Arg-Phe-Met-An by…

A: Proteins are one of the macromolecules present in the body. They provide structural support,…

Q: Name the protein structural element shown in yellow in the figure:

A: Proteins can be defined as large biomolecules. They comprise of one or more chains of amino acids.…

Q: Given the following non-coding strand of DNA nucleotides:G T T C C C T T T G G A A C C T G G Write…

A: Nucleic acids are the essential macro molecules that carry and transmit genetic information in the…

Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…

A: A mutation is a change in a DNA sequence. It can result from DNA copying mistakes made during cell…

Question

Which of the following sequences is most likely to form an unstructured loop in a protein structure?

A. GPGGGGGPGGG

B. VEELLSKVKQLADA

C. KVDFHVNDVEVKMH

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

The figure below shows a portion of a B sheet in the interior of a protein. The strands are labeled A to D. For each strand, determine whether it is anti-parallel or parallel to its adjacent strand. In the figure, the red lines represent hydrogen bonds, the gray spheres are oxygen atoms and the N-labeled blue spheres represent the amino group. N I N N N N N I 'N A В A is [ Select ] to B. B is [ Select ] v to C. Cis [ Select ] to D.
I’m not sure which answer is correct for this question can you please help?
Draw the structure of the first 3 nucleotides in the nucleic acid sequence attaaaggtt tataccttcc caggtaacaa accaaccaac tttcgatctc ttgtagatct gttctctaaa cgaactttaa aatctgtgtg gctgtcactc ggctgcatgc ttagtgcact
Let’s suppose we have downloaded the structure of Hemoglobin from PDB. Now we want to retrieve the location of helices and loops in it. How can we do it? How can we depict a protein’s coordinate info in a modeling program? (Subject: Bioinformatics)
How many amino acids (aa) does your protein have? 1,106 aa 551 aa 1,367aa 508aa 1,210 aa Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcc cggaccccaagttcgagagcaaagcggccttgctggcggcccgggggcccgaagagcttctgtgcttcaccgagcggttggaggactt ggtgtgtttctgggaggaagcggcgagcgctggggtgggcccgggcaactacagcttctcctaccagctcgaggatgagccatggaag ctgtgtcgcctgcaccaggctcccacggctcgtggtgcggtgcgcttctggtgttcgctgcctacagccgacacgtcgagcttcgtgcccct agagttgcgcgtcacagcagcctccggcgctccgcgatatcaccgtgtcatccacatcaatgaagtagtgctcctagacgcccccgtgg ggctggtggcgcggttggctgacgagagcggccacgtagtgttgcgctggctcccgccgcctgagacacccatgacgtctcacatccgc tacgaggtggacgtctcggccggcaacggcgcagggagcgtacagagggtggagatcctggagggccgcaccgagtgtgtgctgag caacctgcggggccggacgcgctacaccttcgccgtccgcgcgcgtatggctgagccgagcttcggcggcttctggagcgcctggtcg gagcctgtgtcgctgctgacgcctagcgacctggaccccctcatcctgacgctctccctcatcctcgtggtcatcctggtgctgctgaccgtg…
how many nucleotides are in CAGATTGTGAAGAGGTCTCTTGA consensus coding sequence? Answer in numerical digits only
Nevaeh Kendall BIOL 101 - Extra Credit Transcription and Translation To receive full credit, you must have this handout completed and submit on Monday, December 4, 2023, at the beginning of class. You should complete the McGraw Hill Connect Reading for Chapter 25. DNA->>> Strand (a) DNA (coding) 1. If the sequence of a DNA strand is AAT CGTCTAAGGCC, then the complementary sequence has the following sequence: 2. Complete the following diagrams illustrating. DNA (template) mRNA Transcription to mRNA tRNA amino acid Translation - Amino Acids Chain to tRNA A T G G Protein Synthesis T T G d T A A ဝဝဝဝဝဝဝဝဝဝဝဝဝဝ T A оооо 5 66 d 8890 889 oggoggage оо
The following sequence is part of a globular protein. Predict the secondarystructure in this region.cRRPVVLMAACLRPVVFITYGDGGTYYHWYH c
You want to translate a polycistronic bacterial MRNA in eukaryotic cells. You remove all stop codons except the last stop codon in the bacterial DNA before inserting it into the genome of a eukaryotic cell. Can you get a functional protein using this method? Yes or No. Briefly justify your answer.
Define the following terms:a. geneb. mutationc. hydrocarbond. hydrophobice. hydrophilic
What is the first amino acid encoded in your protein? A. Methionine B. Asparagine C. Proline D. Cysteine Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcc cggaccccaagttcgagagcaaagcggccttgctggcggcccgggggcccgaagagcttctgtgcttcaccgagcggttggaggactt ggtgtgtttctgggaggaagcggcgagcgctggggtgggcccgggcaactacagcttctcctaccagctcgaggatgagccatggaag ctgtgtcgcctgcaccaggctcccacggctcgtggtgcggtgcgcttctggtgttcgctgcctacagccgacacgtcgagcttcgtgcccct agagttgcgcgtcacagcagcctccggcgctccgcgatatcaccgtgtcatccacatcaatgaagtagtgctcctagacgcccccgtgg ggctggtggcgcggttggctgacgagagcggccacgtagtgttgcgctggctcccgccgcctgagacacccatgacgtctcacatccgc tacgaggtggacgtctcggccggcaacggcgcagggagcgtacagagggtggagatcctggagggccgcaccgagtgtgtgctgag caacctgcggggccggacgcgctacaccttcgccgtccgcgcgcgtatggctgagccgagcttcggcggcttctggagcgcctggtcg gagcctgtgtcgctgctgacgcctagcgacctggaccccctcatcctgacgctctccctcatcctcgtggtcatcctggtgctgctgaccgtg…