Answered: Which of the following is NOT a…

Name: Which of the following is NOT a component of the 30S initiation comple
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the following is NOT a component of the 30S initiation complex?A. EF-Tu and EF-TsB. f-met-tRNAC. initiation factorsD. mRNA

Science

Biology

Which of the following is NOT a component of the 30S initiation complex? A. EF-Tu and EF-Ts B. f-met-tRNA C. initiation factors D. mRNA

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 11SA: _______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acids

See similar textbooks

Related questions

Q: Why the synergy test results demonstrated that Penicillin G and Gentamicin did not act…

A: Penicillin and gentamicin gave synergistic bactericidal and post-antibiotic effects (PAEs) which…

Q: How might brain shape reveal clues about hominin history? The globe-shaped brain of modern humans…

A: Modern human beings are the result of the evolutionary process. Over the years, scientific research…

Q: You made your material in the lab and wish to test for biocompatibility in vitro with a direct…

A: Biocompatibility is the process in which the compatability of the skin can be mediated by using…

Q: The effective population size is often much smaller than the basic number of individuals in a…

A: Solution The number of breeding individuals in an idealised population with the same genetic drift…

Q: a. 5 Ends b3 Ends c. Hydrogen Bond d. A Nucleotide e. Deoxyribose Sugar f. Phosphate 9. Each base…

A: DNA is also known as the oxy ribonucleic acid. It is present in all the prokaryotes and eukaryotes…

Q: Comparative genome analysis of Modern human, Neanderthal and Denisovan genomes by Joshua Akey and…

A: Comparative genome analysis of Modern human, Neanderthal and Denisovan genomes by Joshua Akey and…

Q: What is the difference between semi-conservative replication and dispersive replication?

A: DNA The DNA or deoxyribonucleic acid is made up of four nucleotide sequence adenine, guanine,…

Q: Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’…

A: Template DNA: 5’ATGACGGAATATAAGCTGGTGGTGGTGGGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’…

Q: 1. 2. 3. 4. 5. Most Recent Varieties STRAWBERRY Its Characteristics How It Was Developed

A: Strawberries are best planted in the spring as early as several weeks before the last prose date by…

Q: Describe the reproductive cycle of a retrovirus, such as human immunodeficiency virus (HIV).

A: Introduction Viral infections are very harmful to mankind. In the post century where we faced the…

Q: Explain how the femur of a child can increase in length and diameter to become the length and…

A: Osteogenesis is the process of bone development or growth. The production of bone tissue is divided…

Q: Create a level of organization of all the parts of the tilapia fish.

A: Introduction - Tilapia is a fish that is solely found in Africa, and many states in the United…

Q: In some viruses, capsomeres function as enzymes as well as structural supports. Of what advantage is…

A: Viral capsids are nanometre-sized containers that possess complex mechanical properties and main…

Q: The trp operon is a repressible operon system. What does this mean?

A: Trp refers to tryptophan. The operon is the functional unit of Deoxyribonucleic acid ( DNA) having…

Q: Question 49 A group of antibiotic-resistant genes is known as a bundle. cassette. conjugate.…

A: Antimicrobial resistance develops whenever bacteria, viruses, fungi, and parasites evolve and no…

Q: 1. usually, what type of molecules are present in the peripheral SMAC? 2. usually, what type of cell…

A: ANSWER;- 1. In the center is the central supramolecular initiation complex or cSMAC, which contains…

Q: Which of the following best describes a feature/s of fats that makes them an ideal energy storage…

A: *Lipids are one of the four biological macromolecules which perform many functions in different…

Q: Which of the following would explain the formation of double-stranded loops in tRNA? A.…

A: tRNA stands for transfer RNA. It is responsible for transferring the amino acids from cytoplasm to…

Q: Describe the effects of streptococcal haemoysins giving an example of streptococci that can manifest…

A: A "microbe" is a living entity that is so tiny that it cannot be seen with the naked eye.…

Q: As the run began the levels of carbon dioxide in the soldiers’ body began to rise. Explain how and…

A: Co2 is a result of cellular metabolism that is delivered to the lungs via the bloodstream before…

Q: 3.Histamine is a signaling molecule that plays a significant role in regulating immune responses…

A: Histamine is a nitrogenous organic molecule that has a role in local immunological responses, as…

Q: decide to implant the material on the left leg of the mouse and use the right leg as your control.…

A: The immune response is the response generated by the body in response to encounter with foreign…

Q: You notice that the tails of the phages in one lab stock are shorter than the tails in another lab…

A: The phage tail is a complex, multi-protein structure that mediates attachment, digestion and…

Q: At initial contact, the ankle should be Dorsiflexed Select one: True False

A: Bones make form the skeleton. Different types of bones are connected to one another in a certain…

Q: Answer briefly and concisely. The survival, growth and reproduction of microorganisms are…

A: The common practices used in the above given examples are having the principles of retarding the…

Q: Animals with three tissues layers have other synapomorphies that differentiate them from…

A: Biology is the study of cells, tissues, organs, organ systems, organisms, species, and communities…

Q: What are the different applications of ELISA?

A: ELISA is the basic assay technique, known as enzyme-linked immunosorbent assay (also referred to as…

Q: After studying the phylogeny of the Lassa virus, scientists discovered that viruses from different…

A: * After studying the phylogeny of the Lassa virus, scientists discovered that viruses from different…

Q: Driving Forces An increase of population in Barangay Camp 4 Tuba, Benguet was recorded during the…

A: There are few important points: A population is a collection of individuals of the same species that…

Q: Bacteria that were once treatable through the application of antibiotics are now resistant to them,…

A: *Antibiotics are nothing but medicines that fight against bacterial infections by killing the…

Q: The following taxa have many species that commonly reproduce asexually. Choose all that apply.…

A: Out of the given options, the species that commonly reproduce asexually are - Platyhelminthes,…

Q: Bacterial DNA will be recognized by innate immune cells though binding to: O TLR8 O TLR9 TLR2 TLR4

A: Innate Immunity: Immunity that is innate, or nonspecific, is a protective system that you were born…

Q: You perform a Gram stain on some yogurt that you made. What type of organisms do you expect to see…

A: INTRODUCTION Fermentation Fermentation is a process by which carbohydrate converted into sugar and…

Q: Answer the following questions based on the lac Operon metabolic pathway.

A: Gene Regulation In prokaryotes , control of the rate of transcription is the site for control of…

Q: in the abs The diagram shows the process of cellular respiration both in the presence an oxygen.…

A: Aerobic respiration takes place in the presence of oxygen. The fermentation pathways of energy…

Q: Based on the figure below, what is the number of turnovers in stage B? D 34 24 16 4 Geological…

A: Species turnover is defined as the number of species in a specific geological age which pass over to…

Q: ndustrial effluent from a metal processing factory released Cu into a nearby river without any…

A: Introduction The act of observing and measuring the state and continuing changes in ecosystems,…

Q: 10. Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present…

A: Disclaimer : Since you have posted a question with multiple subparts, we will solve first three sub…

Q: 15.In innate immunity, physical and chemical barriers serve as the human body's first line of…

Q: Arecaceae or the palm family has a tropicopolitan distribution with some extensions in the…

Q: According to the progressive, or escape, hypothesis, viruses (a) appeared before the three domains…

A: Virus is a relation between living and non living world and it is infectious. This is because ,…

Q: Why are nonnative species often considered a disturbance in an ecosystem? They increase mutations.…

A: Introduction :- Non-native species are organisms that do not naturally occur in a given area but are…

Q: DNA polymerase δ: DNA polymerase III as ________ a. Helicase: RPA b. DNA ligase: DNA polymerase I…

A: a) RPA stimulates helicase-catalyzed DNA polymerase III unwinding, enlists translocases to sites of…

Q: How is maternal inheritance different from the segregation Mendel observed for nuclear genes

A: The maternal inheritance is different from the segregation that Mendel observed for nuclear genes.…

Q: * 3. If 612,300 individuals died on the same year, what was the death rate? 0.25% 0.5% 1.5% 2%

A: The population is the collection of all individuals of a particular species that are located in a…

Q: Illustrate the schematic diagram of polymorphic DNA

A: DNA polymorphisms include: (1) RFLP – restriction fragment length polymorphism; (2) VNTR – variable…

Q: What conclusion can be drawn from embryological development? Insect and bird wings are similar in…

A: Embryo It is the structure that if form after the fertilization of egg and sperm.

Q: 15.Where does the complete digestion of food occur in the gastrointestinal tract? Read and analyze…

A: The digestive system is responsible for the digestion, absorption and assimilation of nutrients that…

Q: The behavior an animal exhibits that relates to their resource exploitation within their habitat is…

A: Ecology is defined as the study of the environment, and it helps us understand how species coexist…

Q: HIV1/2 refers to A. HIV antigen 1 and 2 B. HIV antibody 1 and 2

A: Introduction The human immunodeficiency virus (HIV) is a virus that causes infection in humans. By…

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

Which of the following is NOT a component of the 30S initiation complex?

A. EF-Tu and EF-Ts

B. f-met-tRNA

C. initiation factors

D. mRNA

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step 5

Step by step

Solved in 5 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following processes degrades mRNA molecules after transcription if they have a sequence complementary to a small non-coding RNA? O A. RNA blocking B. RNA interference OC.post-translational modification O D. Alternative splicing
Formation of the 70S ribosomal initiation complex for prokaryotic translation requires: a.tRNAfMet b.tRNAMet c.GTP d.EF-Tu e.IF-2 f.Mn2+
Describe the following a. Core enzyme RNA polymerase b. Sigma factor c. Promoter consensus sequence d. Rho Dependent Factor e. Intrinsic Factor f. Abortive Initiation
Formation of the 70S ribosomal initiation complex for prokaryotic translation requires A. Mn2+ B. EF-Tu C. tRNAMet D. tRNAfMet D. IF-2 E. GTP
Procedure This activity will use the Human β-hemoglobin gene, which is mutated in sickle cell anemia, with the following sequences of the first thirty (30) nucleotides: TAC CAC GTG GAC TGA GGA CAC CTC TTC AGA... 1. First transcribe the DNA sequence into the mRNA sequence. 2. Refer to the genetic code to write down the amino acid sequence that these 30 nucleotides encode beginning with the first nucleotide. 3. Generate a random number (1-30) by drawing lots in a bowl. Then locate the DNA nucleotide to "mutate" using the number drawn as the position along the gene. 4. "Roll" the tetrahedron "mutator" dice (see direction below for making the tetrahedron "mutator" dice). Note the letter on the side that is flat on the table. That is the nucleotide that will replace the nucleotide in the DNA at the position decided in the previous step. 5. Write the mutant nucleotide sequence in the row for Mutation 1, then analyze mutation. a. If it is the same nucleotide, write same nucleotide…
a. promoter region b. RNA polymerase C. antisense strand d. poly-A tail e. 5' cap f. splicing 8. anticodon loop h. acceptor stem L peptide bond A site 1. connects amino acid to polypeptide chain and leaves tRNA 2. transcribed strand that will go on to translation 3. recognized by the protein synthesis machinery 4. part of tRNA with nucleotides complementary to MRNA 5. enzyme that connects RNA nucleotides to DNA template 6. site where tRNA with amino acid enters the ribosome - 7. intron sequences are removed and exons are combined together 8. region of DNA with sequences that com bìne with RNA polymerase 9. site where amino acid combines with ERNA 10. makes RNA mare stable in the cytoplasm
What happens when EF-Tu is mutated A. Be involved in transcription instead of translation B. Peptide bond formation is inhibited C. Incoming tRNA will not be able to enter through the A site D. Incoming tRNA will not be able to enter through the P site
During the termination of translation, what is the correct polypeptide sequence which will be released by the ribosome? 5' - AUG - UAU - CUC - UUU - 3' (mRNA codon sequence) 3' - UAC - AUA - GAG - AAA - 5' (tRNA anticodon sequence) A.START - Tyr - Leu - Phe B. Tyr - Ile - Glu - Lys C. START - Ile - Glu - Lys D. Ser - Tyr - Gly - Cys
Choose the item in column 2 that best matches each item in column 1. A. Provides information for production of protein B. Binds to promoter C. Promoter has a box A and box B consensus sequences D. Autocatalytic RNA molecules E. Associated with transcription termination F. Polymerization of ribonucleotides to form RNA molecules G. 7-methyl guanosine H. MRNA prior to processing select - 1. Core RNA polymerase select 2. rho (p) factor select 3. hnRNA select - 4. RNA select -5. RNA polymerase holoenzyme select 6. Ribozymes select - 7. 5' MRNA cap select 8. MRNA
Which of the following statements are true about eukaryotic mRNA?a. The sigma factor is essential for the correct initiationof transcription.b. Processing of the nascent mRNA may begin beforeits transcription is complete.c. Processing takes place in the cytoplasm.d. Termination is accomplished by the use of a hairpinloop or the use of the rho factor.e. Many RNAs can be transcribed simultaneously fromone DNA template
f you made a change in the promoter sequence in the DNA that inactivates the promoter, what would happen at the RNA level? A-Nothing, because the RNA would be made as usual B-Transcription factors would be unable to bind and the RNA polymerase would not be recruited to the DNA, so no RNA would be made. C-The mutation of the DNA would be carried through to the RNA sequence. D-The DNA helicase would not be able to recognize and bind the DNA, so the RNA would not be made. EXPLAIN WHY THE ANSWER YOU CHOOSE IS CORRECT
Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?