Q: Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and 2 are…
A: Introduction :- Exons are the coding regions of an RNA transcript or the DNA that codes for it that…
Q: Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before…
A: The transcription is the process by which RNA is produced from DNA. In case of eukaryotic mRNA, it…
Q: Consider this list (below) of steps involved in transcription. These steps are out of order.…
A: Replication, transcription, and translation are used by all cells to keep track of their genetic…
Q: Alternative splicing a. increases the number of proteins made from one gene b. increases the number…
A: in alternative splicing there is a selection of different types of sites of splicing which can…
Q: Alternative splicing takes place in more than 95% of the human protein-encoding genes with multiple…
A: In alternative splicing, a single pre-mRNA may be spliced in two or even more ways depending upon…
Q: What type of genetic regulation seems to be the most similar between prokaryotes and eukaryotes?…
A: Genetic regulation is defined as the process of switching genes "ON" and "OFF" to see in a cell's…
Q: Bacteria use the same stop codons as eukaryotes. However, bacterial transcription is also terminated…
A: The transcription in prokaryotes is either terminated by rho-dependent or rho-independent process or…
Q: Which of the following best explains how the expression of a eukaryotic gene encoding a protein will…
A: The central dogma is common throughout the life forms on earth: i.e. DNA to RNA to Protein. Having…
Q: Draw the SMN2 pre-mRNA (10 exons and 9 introns), indicate the 5’ and 3’ SS location. Draw the SMN2…
A: Proteins are obtained from DNA that contains the required genetic information. DNA is first…
Q: Which of the following is/are a role for the poly-A tail? (Select all that apply.) a) Facilitates…
A: Polyadenylation is a post-transcriptional modification process where the PolyA tail containing…
Q: The gene ABCD is 1500 bases long What would be the likely length of the pre-mRNA molecule? ____ What…
A: INTRODUCTION Exons are coding sections of an RNA transcript, or the DNA encoding it, that are…
Q: a) Two of the following three mRNA sequences code for the same protein. Delete the sequence which…
A: Translation is defined as the process where the nucleotide sequence in the mRNA is translated to…
Q: In forming the lariat structure during splicing which of the following attaches to the branch point…
A: A defining feature of this process is the creation of 2' -5' phosphodiester linkage at an adenosine…
Q: Introns are intervening sequences; what are exons?
A: A gene is an essential unit of heredity and a sequence of nucleotides in DNA or RNA that encodes the…
Q: In Figure 8-15, what do you think would be the effect of a A to G mutation in the branch point…
A: When the nucleotides sequences in the genome of an organism are altered or changed due to mistakes…
Q: Which of the following makes alternative RNA splicing possible? Group of answer choices A. Parts of…
A: Option A
Q: Which of the following statements about pre-mRNA splicing is FALSE? a. Splicing of an intron…
A: RNA splicing is a kind of RNA processing in which a newly formed pre-mRNA transcript is transformed…
Q: Which of the following is TRUE about MRNA splicing? O a. Splicing occurs after complete mRNA is…
A:
Q: Which of the followings best describes the histone mRNA structure? histone mRNAs end in a…
A: A histone is a protein that provides structural support to a chromosome. In order for very long DNA…
Q: Which of the following statements regarding splicing in eukaryotes is correct?a) Several reactions…
A: DNA is the genetic material that carries genetic material in the form of coded nucleotide sequences.…
Q: Which of the following statements about the attempt to express a eukaryotic gene in bacteria is…
A: The regulation of gene expression in eukaryotes occurs at several level, which is far more diverse…
Q: After transcription has been completed in eukaryotes, the mRNA molecule first goes through some…
A: Nucleus is main controller of the cell which carries genetic instructions . It contain thread like…
Q: Once transcribed, the length of the mRNA for gene X is usually 1000 nucleotides long in your…
A: Rho utilization site , also known by the acronym rut is a sequence of RNA in bacteria upstream of…
Q: When a eukaryotic gene is cut out of genomic DNA, geneticists have discovered that enabling the…
A: A gene is sequence of DNA, which codes for an mRNA through transcription. During the replication…
Q: Which of the following is NOT a true statement about the 5' cap? O A. The Cap Binding Complex (CBC)…
A: The five-prime cap (5′ cap) is a specially altered nucleotide on the 5' end of some primary…
Q: Which of the following could not affect splicing? A. Mutation that changed the sequence of a…
A: The basis of inheritance is the information passed down from parent to offspring. The replication of…
Q: After an MRNA primary transcript is created, a modified guanine nucleoside triphosphate is added to…
A: The genetic information in a cell is processed in a series of steps namely replication,…
Q: Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA?…
A: Genetic codes are unambiguous that means one codon will code for only one amino acid. Codons are…
Q: Alternative splicing can occur when a cell-specific protein binds to a transcript, blocking a splice…
A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…
Q: man rhodopsin gene is 2675 nucleotides long from transcription start site to transcription stop…
A: The rho factor provides directions for creating a macromolecule referred to as rhodopsin. This…
Q: explain which sequences within the pre-mRNA determine where splicing occurs? How? Why?
A: Splicing of a pre-mRNA molecule occurs in several steps that are catalyzed by small nuclear…
Q: Nascent form of the mRNA A. undergoes splicing only after capping B. is also called hnRNA C. is…
A: A. undergoes splicing only after capping B. is also called hnRNA D. participates in the spliceosome…
Q: The diagram shows a pre-MRNA before splicing and processing. In this cell type, a protein is present…
A: RNA-Splicing: In molecular biology, RNA splicing is the process by which a newly synthesised…
Q: In eukaryotes, why is the initial RNA transcript usually longer than the mature mRNA molecule?…
A: Transcription is the process by which messenger rna is made from DNA. This process takes place…
Q: Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An…
A:
Q: Which modification of eukaryotic mRNA is likely absent if the mRNA can leave the nucleus but cannot…
A: mRNAs are formed in the form of primary transcripts.
Q: the processing of pre-mRNA in eukaryotes Select one: a. Exons are joined together using…
A: In Prokaryotes; both Transcription and translation process takes place in the cytoplasm; but in…
Q: Which of the following would not be the consequence of alternative splicing? Two genes to express…
A: Alternative splicing is the method of producing differentially spliced mRNAs by choosing alternative…
Q: Sequences in the beginning and end of a typical human intron are: GU and AG GG and AG UA and UA…
A: RNA splicing is a form of RNA processing in which a newly made precursor messenger RNA transcript is…
Q: Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered…
A: Transcription is the process which are answerable for integrating the RNA from the DNA by the…
Q: A mutation has occurred to a wild type mRNA sequence: Wild Type: 5’-AUG-UUG-CAA-GCG-3’ The new…
A: A mutation is a change in the nucleotide sequence of the DNA of an organism. Mutations can be caused…
Q: With regard to RNA polymerase proofreading ability, which of the following is true? OA 3'5'…
A: Answer : with regard to rna polymerase proof reading, the true statement is : no proofreading…
Q: A eukaryotic protein-encoding gene contains two introns and three exons: exon 1–intron 1–exon…
A: Splicing is a process of removal of non-coding sequences and the joining of coding sequences. The…
Q: Which one of the following options is NOT a step in RNA processing? Addition of the 5’ G cap…
A: Inside the cells of any organism, RNA is considered an essential biomolecule as it performs a…
Q: Based on the electron micrograph shown, which of the following statements is/are correct/true?…
A: Introduction :- Microorganisms, cells, big molecules, biopsy samples, metals, and crystals are among…
Q: For each of these things, say whether it describes the coding sequence or the regulatory sequence.…
A: Coding sequences are sequences or portions of a gene or mRNA which codes for a protein. The coding…
Q: How would the removal of the TATA box in a eukaryotic gene impact transcription? Group of answer…
A: A gene is the stretch of DNA that codes for a polypeptide.
Q: Which of the following is an example of chromatin modification that stimulates gene expression?…
A: Chromatin is basically the thread like structure that is present in the nucleus during the non…
Q: Draw the SMN2 mature mRNA before treatment with Spinraza
A: To better understand let's revise that the DNA is the hereditary molecule that transfers genetic…
A process that helps a single gene to code for many proteins is known as alternate splicing. It is also known as alternate RNA (ribonucleic acid) splicing or differential splicing. Alternate splicing takes place during the gene expression. The proteins derived from alternate splicing of mRNA contain differences in their sequence of amino acids.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- IS. Alternative splicing has been estimated to occur in more than 95% of multi-exon genes. Which of the following is not an evolutionary advantage of alternative splicing? Alternative splicing increases diversity without increasing genome size Different gene isoforms can be expressed in different tissues Alternative splicing creates shorter mRNA transcripts Different gene isoforms can be expressed during different stages of development.The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never madeA eukaryotic structural gene has two introns and three exons : 5prime end exon1 intron1 exon2 intron2 exon3 3 prime end The GU at the 5’ end of intron2 has been mutated so it is no longer recognized What would the mature mRNA look like in the wild type and in the mutant? 1-wild type? 2-mutant type?
- 38.start with four exons and show mutually exclusive splicing producing 1-2-4 and 1-3-4 spliced exons. Second, start with two exons and show alternate 5’ splicing producing 1-2 and 1a-2 spliced exons. In one cell type, the 1a-2 isoform is more prevalent. Explain how SR protein binding to an ESE would regulate this preferred isoform. Be sure to include U1 in your response and define ESE.1. For the genotypes and conditions (lactose present or absent) shown in the following table predict whether functional enzymes, nonfunctional enzymes, or no enzymes are made. 2. Even though the LacZ,Y and A structural genes are transcribed as a single polycistronic mRNA, each gene contains the initiation and termination signals essential for translation. Predict what will happen when a cell growing in the presence of lactose contains a deletion of one nucleotide early in the Z gene and early in the A gene.Which of the followings indicate the order of procaryotic mRNA degreadation? cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme cleavage of the triphosphate 5′ terminus to yield a monophosphate- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- 3′ to 5′exonuclease digestion The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion
- The sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).2b) Prokaryotic cells can and do produce "polycistronic" mRNAs, which have multiple independent coding sequences coding for separate proteins on the same mRNA strand. Eukaryotic cells don't have polycistronic mRNAs, because only the first (most 5') coding sequence on such an mRNA would ever be translated in a eukaryotic cell. Explain why this is the case - why wouldn't a second, more 3' coding sequence on an mRNA be translated in a eukaryotic cell?In addition to splicing, additional modifications at the ends are required to generate a mature MRNA. What are these modifications and what are their significance? Use the following terms to fill in the blanks: MRNA cap poly(A) tail nucleus cytoplasm ribosome transcription complex synthesis degradation modifications The 5' end receives a while the 3' end gets a These modifications allow the MRNA to be exported to the A · protect it from and helps the MRNA to be recognized by the
- Which of the following statements about the mechanism of splicing is correct? 1. A mutation in a 5' splice site will always lead to a shorter mRNA. 2. Mutations in a non-splice site (for example, middle of an intron) does not affect the protein. 3. snRNPs at a 5' splice site can recognize and bind to snRNPs at another 5' splice stie. It is possible that a mutation in a splice site can lead to the removal of an exon. 4. A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only O E. All of 1, 2, 3 and 4 are correct.Imagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow Fluorescent Protein (YFP). To generate the YFP, you know the pre-MRNA looks as follows: Unspliced YFP premature mRNA Сap 5' UTR Exon 1 Intron Exon 2 Intron Exon 3 3' UTR Poly-A tail If Exon 2 is also required for mRNA stability, what can be predicted from the possible spliced alternative isoforms formed? One of the isoforms will not have a poly-A tail O The alternative splicing of YFP pre-MRNA prevents 5'-capping The MRNA isoform without Exon 2 will be degraded faster than the other isoform Exon 2 will be added to isoform B later to correct the mistake in splicing The protein translated from one of the mRNA isoforms will possess an additional functional domainIn eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the nucleus. The pre-MRNA is spliced, given a polyA tail and a cap. Examine the pre- MRNA shown below, then choose the one mature MRNA it would become aftër post-transcriptional modification. Pre-MRNA 5' EXON R INTRON A EXON S INTRON B EXON T 31 polyA tail S сар 3' • 5' сар T polyA tail 3" сар polyA tail 3' polyA tail RAS в т сар 3" RAS BT polyA tail 3' сар