Which of the following is a transversion mutation Select 4 correct answer(s) OA --> T OC--> T C --> G OA --> G OA --> C G --> T

Only need help with parts a,b and c please, and thank you!

Im having trouble answering this question.  What type of cells can be altered by GETs like CRISPR and what types of cells cannot and why is this so?

THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the B chain of hemoglobin. The B chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA? 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 8. 7. What mRNA will be formed from the mutated template strand of DNA? What amino acids will this new mRNA from the mutated template strand code for? 9. Are these new amino acids the…

| 四 ii D YouTube W Maps 6 viewbook-for-sim. Aid & Awards - Of.. O 2022-23_UAB_pa. W Student Z - McMa. Transfer your Gma. M MarkBook CON. (a) What type of mutation would be least harmful to an organism: silent, missense, or nonsense? Explain your answer. (b) What is the difference between gene mutations and chromosomal mutations? Paragraph В I. + v ... Lato (Recom... 19px... v 民 Add a File Record Audio Record Video MacBook Pro

Using the picture below determine the type of mutation that has occurred. Mutated Chromosome Original Chromosome

Does not list the type of mutation

what is the minimum edit distance between the following pair of sequences? TTGACG         TTTAGT - 0 - 1 - 2 - 3

The following is an example of what type of mutation? Normal DNA: 5' - ATGACGTCA - 3' Mutated DNA: 5' - ATGAGTCA - 3' Deletion Insertion Frameshift Silent

Please Write at your own words -Explain this How we can treatment for the genetic disorders by using gene therapy?  Please explain at your own words, please.