Can someone give me a few inherited disorders that are NOT caused by mutations? and if possible, please explain/name a gene that contributes to this disorder? Thank y

Q: Direction: On the worksheet, all the DNA sequences run from 3' to 5'. Supply the corresponding amino…

A: 3' TAC TCC GGC TCT CCC AGT TGA ACT 5' The sequence given is 3' to 5' sequence. Let us transcribe it…

Q: Consider the following mRNA molecules and the amino acids they code for. The second mRNA molecule is…

A:

Q: 1. What is a codon? 2. For eaxh of the following mRNA codons, give the tRNA anticodon and determine…

A: Central dogma of cell comprises of two important processes. They are transcription of DNA into mRNA…

Q: What are genetic disorder that cause by the following substances/product? Just give one genetic…

A: Genetic disorders are diseases caused in whole or in part by a change in the DNA sequence away from…

Q: A mutant monkey was identified that showed resistance to a viral disease 'Kansah'. The kan gene,…

A: In molecular biology, PCR (polymerase chain reaction) plays an important role. With the help of this…

Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…

A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…

Q: Quetsion 3. The tube used for CBC has a mark for 2 ml. The phlebotomist add 4 ml of blood to the…

A: Complete blood count (CBC) tubes are used for determining increase,d decrease, or any other…

Q: How are ribosomes affected in treacher Collins Syndrome disorder? Please write it in a…

A: Treacher Collins syndrome (TCS) is a genetic disorder which is characterized by deformities of the…

Q: Direction: Match the following terms in the other column. Write your answer on the space given.…

A: Answer

Q: What is mature mRNA and how it is made. What kind of enzymes are involved in making of mature mRNA?

A:

Q: A couple has a child with neurofibromatosis. They come to your genetic counseling office for help.…

A: The mode of inheritance is a pattern of obtaining parenteral alleles  or genes to the offspring's.…

Q: Part III-PGD? Suzanne and David decided to have children. They wanted to ensure that their children…

A: NOTE: according to the answering guidelines, I am going to answer only first question. Please post…

Q: help me by drawing the following chemical structures for cancer therapy; thank you in ADVANCE!…

A: Treatements for cancer (cancer therapy) are of different types, like chemotherapy, immunotherapy,…

Q: Gene: Yfh1 The name of the protein and its function in yeast. What effect the protein has on the…

A: yfh1 gene Promotes the synthesis of heme additionally because the assembly and repair of…

Q: ACTIVITY 3. POINT MUTATION Directions: Translate the genes in the TRNA into amino acids. Then,…

A: Introduction  Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: 2. Lucy has fair (light) skin, red and wavy/curly hair. Use the model of her parents' genes above to…

A: The process of inheritance involves the transmission of genetic information from parents to progeny.…

Q: 2. Twist transcription factors (TF) play key roles in embryonic development and are largely…

A: Twist transcription factors (TF) play essential roles in embryonic development but are typically…

Q: SigmaS is the stationary phase sigma factor. Which of the following is a likely site for RNAP-Sigmas…

A: Sigma factor-  A sigma factor is a protein needed for initiation of transcription in  bacteria . it…

Q: what is the 6 main basic procedure of genetic engineering?

A: The deliberate introduction of a foreign gene or genes into an organism's genome is known as genetic…

Q: The X's correspond to the missing information. You need to determine what those X's represent DNA…

A: DNA, RNA, and protein are the three principal molecules that store and transmit genetic information…

Q: write a correct terminology/word on column B that meet the description of column A COLUMN A COLUMN…

A: Ribosomes-are minute particles consisting of RNA and associated proteins that function to synthesize…

Q: Mechanization of transportation has allowed mass movement of humans all around the globe in the past…

A: Globalization is a complex and multi-faceted set of processes that has a wide range of effects on…

Q: Mention four human genetic diseases that result from single gene mutation, please answer this…

A: Because of their uncomplicated inheritance patterns (recessive or dominant) and relatively simple…

Q: DNA Repiica TCC cca GTA GAC ATT TTA TTG CCA GTC AAT AAC GcC TTT TTC CAC AGA TAT ACA тот MRNA Strand…

A: DNA is converted into mRNA by transcription. mRNA has the codons, complementary sequence of the DNA…

Q: A woman claims that either David Spade or Andy Richter is the father of her child. DNA samples are…

A: Southern blot is a tool mainly use in molecular biology. This method is used for the detection of…

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…

Q: Choose the correct statement/s regarding gene targeting in embryonic stem cells: gene targeting is…

A: Gene targeting is a replacement strategy based on the homologous recombination of the desired genes.…

Q: What does "indel" stand for? Group of answer choices internal/deleterious insertion/deletion…

A: Indel is a term related to molecular biology and is responsible for causing small variation in the…

Q: 1. What is an allele? 2. What is a point mutation? 3. How are point mutations related to alleles?

A: A mutation is a sudden heritable change in DNA sequence which corresponds to an altered amino acid…

Q: Please help me

A:

Q: How many nucleotides would be necessary to code for 10 amino acids? Please help, I am lost!

A: Introduction :- DNA and RNA are made up of nucleotides, which are the basic building blocks of both.…

Q: Can I get a breakdown on usher sydrome affected mutations?

A: Usher Syndrome is classified into 3 subtypes(I, II, and III) , depending on the genetic responses…

Q: Mission 1.1.1. Genetic linkage occurs when DNA sequences that are close together on a chromosome ter…

A: The phenomena of linkage was first explained by Morgan. According to this phenomena the two genes…

Q: Write a brief paragraph about what a scientist could do with DNA. Could you please help me with…

A: DNA is the genetic material in most of the organisms including hunan. It is a nucleic acid that…

Q: You are a researcher working on a treatment for Hutchinson-Gilford progeria syndrome, an extremely…

A: Hutchinson-Gilford Progeria Syndrome (HGPS) is a rare genetic disorder that results in premature…

Q: Igf-2 is maternally imprinted gene in mammals and in Martians. A Martian couple, B@sb&t (female –…

A: Disorders that result from mutations that occur in the mitochondrial genome will demonstrate a…

Q: define the term name as Missense mutations

A: sometimes a wrong nucleotide will be incorporated in the DNA. that can result in a type of mutation…

Q: controlled by genes. START: DNA is short for in the nucleus of each cell. There are 23 pairs... ...…

A: Introduction: Nucleus is a double membrane bound dense protoplasmic body.It encloses the genetic…

Q: Shown below is the genomic structure of the wild-type gene for the human gene transthyretin. The…

A: Introduction: A nucleotide is an organic molecule that is the building block of DNA and RNA. They…

Q: hough one might think that disease alleles and other deleterious mutations would be eliminated from…

A: Deleterious allele is the allele that is responsible for the development of some serious diseases…

Q: Some chemicals are known to cause mutations in DNA. EMS is a chemical that usually induces a…

A: Ethyl methanesulfonate (EMS) is a mutagenic, teratogenic and carcinogenic organic compound. It…

Q: Obj 29 What is the direction of synthesis of mRNA Obj 29 The end of the mRNA at which the initiation…

A: The protein molecules that the genes in DNA encode are the "workhorses" of the cell, performing all…

Q: karyotyping

A: Karyotype: It is defined as an individual's complete set of chromosomes. Example of the karyotype…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.