Q: DNA DNA Complimentary MRNA sequence tRNA sequence Amino acid code Strand А T A А А G T А T T T A G
A: Assuming the given sequence is sense strand of the DNA. The sense strand is in the direction 5’-3’.…
Q: The genetic code is defined as a series of _______________ in _______________. (a) anticodons;…
A: The genetic code, anticodons, codons, mRNA, and tRNA are all involved in the expression of a gene. A…
Q: Order of Order of Order of Amino Acid bases bases in MRNA | (codon) bases Coded into in DNA in TRNA…
A: As we know DNA contains A T G C Bases and RNA Contains A U G C Bases. mRNA is complementary to DNA…
Q: In which of the following would you find the start codon sequence of a gene? mRNA DNA and…
A: Codons are made up of three consecutive nucleotides. The sequence of start codon is AUG. It…
Q: in cells, most RNA molecules are___ ; most DNA molecules are____ . a. single-stranded;…
A: Cell exhibits genetic material, which helps in the regulation and control of all cellular functions…
Q: What enzyme is responsible for forming peptide bonds between amino acids? Aminoacyl-tRNA synthetase.…
A: Translation is the process of synthesis of protein in the cytoplasm.
Q: Which of the following are responsible for removing introns from RNAS in eukaryotes? Major…
A: RNA splicing : It removes the interrupting, non-coding sequences of the genes (introns) from…
Q: The genetic code is said to be "degenerate" because: There are more amino acids than codons.…
A: Genetic code refers to the triplets of nucleotides. The genetic information of mRNA is read in the…
Q: The codon sequence corresponds most closely to the sequence of the strand. MRNA O coding DNA TRNA O…
A: Most cells contain deoxyribonucleic acid (DNA) as their genetic material. Some also have ribonucleic…
Q: Which of the following is a true statement concerning codons A codon Will be read by RNA…
A:
Q: The following statements best describes the RNA structure EXCEPT
A: RNA is also known as ribonucleic acid, which is present in almost all cells. It is also similar to…
Q: The following statements best describes the RNA structure EXCEPT some eukaryotic RNAS stay in the…
A: Answer : Option (C) is right. - protein synthesis cannot explain the structure of RNA.
Q: DNA C A T G C U MRNA U UG ERNA ionine Amino Acids is synthesized in translation or transcription?…
A: Transcription is the synthesis of m RNA from a DNA template. The translation is the synthesis of a…
Q: Given DNA strand: 5' T G T T A G T C G A A T 3' Write its complementary DNA and its mRNA.
A: The DNA or deoxyribonucleic acid is the double standard helical macromolecule. It is the genetic…
Q: In the genetic code, there are ___ More tRNAs than codons More codons than amino acids The same…
A: The DNA is transcribed into and mRNA sequence by the process of transcription. RNA contains three…
Q: The circled portion labeled Y is known as a(n): O ribosome O DNA molecule codon TRNA molecule O…
A: The translation occurs in the cell's cytoplasm. Firstly, a nascent mRNA or pre-mRNA synthesized by…
Q: Which of the following is not a type of RNA?a. nRNA (nuclear RNA)b. mRNA (messengerc. rRNA…
A: Answer- Transcription is the process of formation of RNA. There are majorly 3 types of RNA- mRNA,…
Q: What are ribosomes composed of? tRNA & proteins mRNA & tRNA rRNA & proteins mRNA & proteins…
A: The ribosomes are composed of two subunits a smaller and a larger and the sizes of prokaryotic and…
Q: Which of the following processes occurs in the nucleus and forms acomplementary copy of one strand…
A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…
Q: An RNA sequence includes 15 bases. How many amino acids does this sequence encode? 3 0 5 O 15 O 45
A: RNA is a molecule that consists of a single strand of nucleotides. It is a product of transcription…
Q: Which of the following RNA molecules is responsible for carrying the code that will be read at the…
A: BASIC INFORMATION TRANSCRIPTION it is responsible for the formation of hnRNA which has the codes…
Q: Which of the following is a nucleotide that is NOT related to heredity? ATGC O RNA DNA O ATP
A: The living organisms contain different biomolecules that includes carbohydrates, proteins, lipids,…
Q: Which one of the following is true of tRNAs? O Each TRNA binds a specific amino acid. TRNAS are…
A:
Q: What does it mean that the genetic code is redundant? It's very repetitive to have to study the…
A: Redundant means degenerate. Codon amino acid arrangement is such that only one amino acid is encoded…
Q: DNA C T A T T G C A C C T G A G T C C A mRNA…
A:
Q: Which of the following is present in prokaryotes but not eukaryotes?a. exonsb. polyribosomesc.…
A: A cell is the fundamental unit of life. All living organisms are made up of one or many cells. The…
Q: How many unique MRNA codons can be constructed from the four different RNA nucleotides? A. 4 В. 8 С.…
A: mRNA codon:- An mRNA codon is a 3 base pair long part of the mRNA that codes for a specific amino…
Q: MRNE * Once the MRNA gets to the ribosome, it tries to fell the ribosome the message, but it doesn't…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: A small section of mRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids…
A: mRNA is a ribonucleotide sequence produced as a result of transcription from DNA. Once the mRNA is…
Q: Which of the following statements best explains why there are many more codons than there are amino…
A: The genetic codon is the sequence of three successive nucleotides present in the mRNA that codes…
Q: DNA Sequence mRNA Sequence (codon) tRNA Sequence {anticodon) AMINO ACID Sequence
A: Introduction DNA (Deoxyribonucleic acid)serves as the genetic material of almost all organisms (some…
Q: DNA: GTACGCGTAT ACCGACATIC 4. MRNA: Codon: Anitcodon: A ANO Amino Acids:
A: The sequence of mRNA (messenger ribonucleic acid) is complementary to DNA (deoxyribonucleic acid).…
Q: Which of the following is not true of a codon?(A) It may code for the same amino acid as another…
A: The genetic code involves the set of rules determining the conversion of nucleotide sequence into a…
Q: Which of the following forms of RNA are NOT found in prokaryotes? Question 8 options: snRNA rRNA…
A: Prokaryotes are the primitive cells that lack membrane bound cell organelles. Nucleus is not…
Q: Which of the following nitrogen-containing bases would NOT be found in a molecule of RNA? guanine…
A:
Q: In RNA, ___________ pairs with adenine. A.Group of answer choices cytosine guanine thymine…
A: RNA (ribonucleic acid) is a nucleic acid which consists of repeating units of ribonucleotides. A…
Q: All of these materials are needed for translation EXCEPT: a) amino acids b) mRNA c) tRNA d) RNA…
A: Translation occurs in four phases: activation (prepare), initiation (start), elongation (make…
Q: Which one of the following is true of tRNAs? TRNAS have special sequences called codons. Each TRNA…
A: Transfer ribonucleic acid (tRNA) is a kind of RNA molecule that unravels a messenger RNA (mRNA)…
Q: An RNA sequence includes 15 codons. How many amino acids does this sequence encode? O 3 05 15 O 45
A: Genetic code is a combination of rules, which allows the translation of information encoded in the…
Q: DNA = CGC AAA CTA AGC TAC ACT AGC GTT TTA ATT MRNA = tRNA = KINDS OF PROTINE;
A: The glide of statistics from DNA to RNA to proteins is one of the fundamental principles of…
Q: Which of the following is something that DNA and RNA have in common They are both nucleic acids They…
A: DNA and RNA are biomoleculrs which carry genetic information which in them in different individual…
Q: Which of the following is true about the genetic code? O The first position of the tRNA anticodon is…
A: Genetics is a biology branch that deals with the study of genes, their variation, and heredity.…
Q: This single stranded nucleic acid has anti codons TRNA MRNA. FRNA. DNA. glucose OOO
A: "Nucleic acid" is a term we use to describe certain large molecules in a cell. So they are actually…
Q: DNA DNA Complimentary MRNA sequence tRNA sequence Amino acid code Strand A т G А A A G T А T т T А G
A: Gene expression is the process by which the information from a gene is used in the synthesis of a…
Q: Which of the following nucleic acids is a component of ribosomes? a.DNA b.Transfer RNA…
A: BASIC INTRODUCTION NUCLEIC ACID Nucleic acid are made up of smaller units These smaller units are…
Q: Choose the option that goes with the blank. The parentheses after the blank are the choices.…
A: Codon are sequence of 3 Nucleotide bases on mRNA that code for specific amino-acid. Anticodon are…
Q: Which of the following molecular structures contan codons? a protein B mRNA C. IRNA D. rRNA and C
A: The genetic material contains the genetic information. It passes the information from parents to…
Q: DNA T A G strand DNA G G strand MRNA codon U TRNA anticodon A Amino acid Alanine Glutamate
A: Genomic DNA contains information about the genes. DNA is a double-stranded molecule composed of two…
Q: Which of the following best describes the fl Amino acid chain Ribosome tRNA MRNA
A: The concept of the flow of information describes through the central dogma describes the flow of…
Step by step
Solved in 2 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
- Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-CysThe following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.
- MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.FIRST BASE UUU- UUC UUA UUG U CUU- CUC -Phe -Leu DNA Sequence tRNA Sequence (anticodon) -Leu CUA CUG AUU- ACU AUC lle ACC AUA ACA Met or AUG Start ACG- GUU GUC GUA GUG mRNA Sequence (codon) AMINO ACID Sequence SECOND BASE C -Val UCU- UCC UCA UCG- CCU CCC CCA CCG GCU GCC GCA GCG Ser -Pro Thr Ala AAG GAU UAU Cys UAC UAA Stop UGA Stop UAG Stop UGG Trp CAU- CGU -His CAC CGC CAA CGA -Gin CAG CGG AAU- AGU- AAC- AGC AAA- AGA AGG GGU- ASP GGC GGA GGG GAC- GAA GAG UGU- Tyr UGC- Asn Lys G Glu Arg 2 1. In your bag is a specific DNA sequence. 2. Copy that sequence in the box below labeled DNA sequence 3. Transcribe the sequence in the appropriate box. 30 Ser 4. Determine the appropriate anticodon sequence. 5. Translate the appropriate sequence into an amino acid sequence using the codon chart above 6. Using the contents of the bag, create your protein. Arg Gly THIRD BASE(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?
- Second letter C A UUU Phenyl- UUC alanine UCU UCC UAU UAC UGU UGC Tyrosine Cysteine Serine UCA UCG UAA Stop codon UAG Stop codon UGA Stop codon UGG Tryptophan UUA A Leucine UUG CCU ССС CAU CAC CUU CGU CGC Histidine C CUC C CUA Leucine Proline Arginine CCA СCG CGA CGG A CAA CAG CUG Glutamine AGU AGC AUU AAU ААС ACU Asparagine Serine AUC Isoleucine A AUA ACC АСА Threonine AAA AGA Methionine; start codon ACG Lysine Arginine AUG AAG AGG U GUU GUC GUA GCU GCC GCA GAU Aspartic GAC acid GGU GGC GGA GGG Valine Alanine Glycine GAA Glutamic GAG acid GUG GCG G Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense mutation? A transversion of A to U Change of nucleotide in the third position Change of nucleotide in the first position A transition of A to G Change of nucleotide in the second position First letter Third letterotein structure urs Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase Unanswered 0 0/1 answered III I III A compound with no electrical charge made up of separate molecules with positive and negative charges that balance each other out. Attaches the appropriate amino acid to a tRNA molecule based on its anticodon. Surprisingly contains a thymine in it despite being a piece of RNA. Recognized by the anticodon UAC. Small group of proteins that assist protein folding. SubmitThe coding (or “sense”)strand(again noticename ANDthe directionality)of DNAthat is known to encode the C-terminal end of a long E. coliprotein has the following nucleotide sequence:5′–CCATGCAAAGTAATAGGT–3′Give the sequence of the last three amino acids of the protein (label the C-terminus).
