Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense mutation? A transversion of A to U Change of nucleotide in the third position Change of nucleotide in the first position A transition of A to G Change of nucleotide in the second position

Q: Which of the following statements about translation is false?     In eukaryotes, the 5' cap and…

A: In molecular biology, the process by which the gene information in the DNA gets converted into a…

Q: Self-bonded and looped sequences near the end of single poly-ribonucleotide chains control gene…

A: Gene is the sequence of nucleotide that encodes a specific protein.

Q: Why will a mistake in the RNA code alone not become a mutation?

A: A change in the genetic code is called a mutation when it becomes a permanent part of the genome of…

Q: Several different nucleic acids are involved in the process of getting a protein produced from a…

A: Sense strand is that strand of DNA double helix which has the translatable protein code in the 5'-3'…

Q: in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…

A: Transcription is the process that involves the synthesis of an RNA molecule from DNA. It is the…

Q: Which of the following types of mutations, resulting in a change in the mRNA just after the…

A: The translation process will result in the creation of proteins. The process of protein synthesis is…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:

A: This question is based on the functioning of mRNA expression.

Q: Group of nucleotides that confers specificity for the appropriate aminoacyl-tRNA synthetase is…

A: tRNA  Transfer RNA or tRNA is help in the decoding of mRNA. It brings up the amino acid to the P…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and…

A: The Central Dogma theory states that DNA makes RNA and RNA makes protein. DNA undergoes Replication…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide…

Q: Which codon codes for the C-terminal residue in the polypeptide structure shown below? H3N 'N' NH3 H

A: GENETIC CODE is the relation between the base sequence of a gene and the amino acid sequence of the…

Q: Indicate which of the following items are associated with transcription or translation.  This could…

A:

Q: In RNA, an atypical base pair is able to form between guanine and uracil. This base pair allows a…

A: Introduction A Base Pair Is Made Up Of Two Chemical Bases That Are Bound Together To Form A "rung Of…

Q: A reversion is a mutation that returns a mutant codon back to acodon that gives a wild-type…

A: A mutation is a change in the DNA sequence, either due to mistakes during DNA replication or because…

Q: Which mRNA sequences would form a structure that is a cue for transcription termination of some…

A: The ending of termination and the process involved in it are called transcription termination. The…

Q: What is the initiator codon in both prokaryotres and eukaryotes? What amino acid is specified by…

A: The codon AUG is known as the START codon as it the principal codon in the deciphered mRNA that goes…

Q: Which of the following types of mutation that changes the mRNA sequence after the codon that…

A: Frameshift mutation is a type of mutation that changes the reading frame via the indel mutation…

Q: If the wild-type codon is GUU, which of the following single-nucleotide polymorphisms lead to a…

A: Understanding the impact of single-nucleotide polymorphisms (SNPs) on amino acid sequences is…

Q: If the DNA sequence that coded for a codon that was complimentary to the ANTICODON AAU underwent a…

A: A mutation may be a change within the sequence of DNA. Mutations can occur as a result of the term…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…

Q: Now imagine that a mutation occurred at the first G in the DNA sequence above and the G became a C.…

A: Hello, thank you for your question, since you have not mentioned the DNA orientation I am answering…

Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…

Q: and each codon is made up of three nucleotide bases. How might an extra single base INSERTION into…

A: Any abrupt changes in DNA nucleotide is called muttaion.Depending on where the changes occurred…

Q: The following DNA sequence is derived from the middle of an exon of a eukaryotic gene. This sequence…

A: The Central Dogma concept states that DNA is duplicated into DNA. RNA is formed from DNA and…

Q: Which of the following base pairings are allowed between an anticodon and the 3' base of a codon,…

A: According to wobble hypothesis, the third nucleotide of anticodon is a wobble and can base pair with…

Q: Noncoding Strand -> 5’ - G   C     C     A   G     G   T       C     A     G   G     T -   3’…

A: The terms used in the question represents the molecules involved in gene expression. A gene is a…

Q: A substitution mutation that results in the formation of a stop codon and premature termination of…

A: Mutations are the alterations or the change that occur in the DNA. Mutagens, like ultraviolet…

Q: A mutation occurs within a gene sequence but no change is detected in the amino acid sequence. What…

A: Mutation is any change in the nucleotide sequence that occur in the DNA which can alter the amino…

Q: AKS 5c1: The model below represents the process of protein synthesis. What is the best description…

A: Central Dogma of Molecular Biology explains the flow of information from DNA to RNA and then to…

Q: The following base sequence is a complete polynucleotide made in a bacterial cell. AUG, GCC, AUG,…

A: The process of transcription entails creating mRNA from a DNA template. A complementary mRNA strand…

Q: The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start…

A: The nucleic acids DNA and RNA are found in all living things. The deoxyribose nucleic acid is DNA,…

Q: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…

A: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…

Q: Indicate whether there is matching (1) or base complementarity (2) between the following nucleic…

A: The template strand is also called antisense strand.  Biosynthesis of mRNA using antisense strand of…