
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question

Transcribed Image Text:Which of the following genes would you expect to contain a signal peptide sequence? Select all that are true.
Oa. SRP
b. SRP receptor
Oc.
A membrane protein
O d. A protein that is destined to be secreted from the cell
U e. Kinesin
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Look at the figure and predict what would happen if the SRPRNA was unable to stimulate the GTPase activities of the GTPbindingproteins within SRP and the SRP receptor.arrow_forwardYou perform a northern blot to determine whether CFTR (Cystic fibrosis transmembrane conductance regulator) mRNA is expressed in small intestine tissue. You do not detect any MRNA in this sample. Which of the following is a valid conclusion from your experiment? O This gene is not expressed in this organism O This gene is likely not transcribed in the small intestine O Small intestine cells do not contain the CFTR gene O There is no MRNA, because it has all been converted to proteinarrow_forwardYou study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. mRNA 20 ORI 40 60 3' GATATTACTGGI АAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАСЕССТАCGTGATAG TTCGAGCTCTCGTCGTCGAGATACGCGATGAT GGTAATATGGGATGCACTATC 5' promoter RNA polymerase Practice Question 4 E) You also study the expression of different mutants for this gene. Mutant A has a single base pair substitution with the C/G being replaced with G/C base pair at position 30 (position denoted by the * in the sequence above). For mutant A answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5'…arrow_forward
- An example of inappropriate expression of a protein and what could be learned from this type of experiment include(s); a. All of these would help a scientist to learn the functions of a protein. b. Limiting the level of protein to identify the variety of functions of a protein. c. Producing too much of a protein to identify the functions of a protein d. Producing a protein too early in development to identify the function of that proteinarrow_forwardThe receptor-associated proteins called G proteins... A. bind GTP. B. can activate or inhibit an effector protein, e.g. adenyl cyclase. C. interact with membrane-associated proteins to influence their function. D. both a and b E. a, b, and carrow_forwardGive a detailed description of how the protein(KRAS) encoded for by your protein normally functions in a cell. What does it do? What does it regulate? Is it an enzyme, transcription factor, regulatory protein, etc.? How does it work?arrow_forward
- Suppose hemoglobin is inhibited at the post-translational level. This means is it regulated at the _____ Select one: a. DNA level and mRNA will not be made b. tRNA level and protein will not be made c. mRNA level and the protein will not be made d. protein level and it will be inactive e. precursor mRNA level and mature mRNA will not be madearrow_forwardIf a gene is mutated, then it may consequently affect the expressed in the central dogma which then may lead to alter the production/function of other bio-molecules. Select one: a. lipids b. carbohydrate С. DNA Ca d. protein Do Is w Wha ( Previous page Next page https:// Jump to... What Mar 13. These m https://bic 2.2A: V MacBook Pro esc n m-wanry ur @ # $ % & 1 2 3 4 6 Q W E Y tab А S D F G caps lockarrow_forwardAll genes regulated by PKA contain a cis-acting DNA sequence that binds to the phosphorylated form of a transcription factor called (choose one answer) a. CREB. b. C-Jun. c. beta-catenin. d. TCF.arrow_forward
- You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 20 ORI 40 60 ТТCGAGCTCTСGTCGTCGAGATACGCGATGAТАТТАСТGGТААТАТСGGGАTGCAСТАТС 3' 5' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCANTATAÇCCCTACGTGATAG promoter RNA polymerase Practice Question 4 A) Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you know? ribosome ||arrow_forwardLooking at the image shown here, which of the following statements DOES NOT correctly match a function or component with its labelled feature? E O A. tRNAS can be found in A. OB. Opsin protein can be found in L. C. Proteins can be found in J. O D. Enzymes can be found in D.arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education