Which of the following genes would you expect to contain a signal peptide sequence? Select all that are true. a. SRP O b. SRP receptor OC. A membrane protein O d. A protein that is destined to be secreted from the cell Oe. Kinesin

Look at the figure and predict what would happen if the SRPRNA was unable to stimulate the GTPase activities of the GTPbindingproteins within SRP and the SRP receptor.

You perform a northern blot to determine whether CFTR (Cystic fibrosis transmembrane conductance regulator) mRNA is expressed in small intestine tissue. You do not detect any MRNA in this sample. Which of the following is a valid conclusion from your experiment? O This gene is not expressed in this organism O This gene is likely not transcribed in the small intestine O Small intestine cells do not contain the CFTR gene O There is no MRNA, because it has all been converted to protein

You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. mRNA 20 ORI 40 60 3' GATATTACTGGI АAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАСЕССТАCGTGATAG TTCGAGCTCTCGTCGTCGAGATACGCGATGAT GGTAATATGGGATGCACTATC 5' promoter RNA polymerase Practice Question 4 E) You also study the expression of different mutants for this gene. Mutant A has a single base pair substitution with the C/G being replaced with G/C base pair at position 30 (position denoted by the * in the sequence above). For mutant A answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5'…