An example of inappropriate expression of a protein and what could be learned from this type of experiment include(s); a. All of these would help a scientist to learn the functions of a protein. b. Limiting the level of protein to identify the variety of functions of a protein. c. Producing too much of a protein to identify the functions of a protein d. Producing a protein too early in development to identify the function of that protein

An individual with the genetic condition cystic fibrosis has CFTR protein with the amino acid histidine (at position 482), where the normal CFTR protein has arginine. No other changes are observed in the protein. This is the result of a ____ mutation. Select one: a. nonsense b. frameshift c. silent d. missense

Which of the following rows identifies the mutated DNA sequence, complementary mRNA sequence, and resulting amino acid in a person with metabolic syndrome? Complementary mRNA Resulting Amino Acid Row A B D. OC. C D. D C Select one: OA A OB B Mutated DNA ATG ATG ACT ACT Metabolic syndrome is a genetic disorder with symptoms such as hypertension, elevated blood cholesterol, and low blood magnesium concentrations. This syndrome is caused by a mutation in which a cytosine nucleotide in the codon ACG is replaced by a thymine nucleotide. Use the following to answer the next AUG UAC ACU UGA Methionine Tyrosine Threonine Stop

Determine which statements could be used as evidence to support the argument that "DNA influences the proteins that are made" and which statements are just facts. [Select all that apply.] The HBB gene that makes beta-globin has several abnormal alleles, including HbS, HbC, and HbE. Sickle cell disease has been successfully treated using bone marrow transplantation in children and adults. The symptoms of sickle cell anemia may not appear in individuals who only carry one HbS allele, but are always apparent when both alleles are HbS. If oxygen is removed from red blood cells made by two HbS alleles, the cell will form a sickle shape.

The process of gene expression involves:

What is the first amino acid encoded in your protein?   A. Methionine B. Asparagine C. Proline D. Cysteine   Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcc cggaccccaagttcgagagcaaagcggccttgctggcggcccgggggcccgaagagcttctgtgcttcaccgagcggttggaggactt ggtgtgtttctgggaggaagcggcgagcgctggggtgggcccgggcaactacagcttctcctaccagctcgaggatgagccatggaag ctgtgtcgcctgcaccaggctcccacggctcgtggtgcggtgcgcttctggtgttcgctgcctacagccgacacgtcgagcttcgtgcccct agagttgcgcgtcacagcagcctccggcgctccgcgatatcaccgtgtcatccacatcaatgaagtagtgctcctagacgcccccgtgg ggctggtggcgcggttggctgacgagagcggccacgtagtgttgcgctggctcccgccgcctgagacacccatgacgtctcacatccgc tacgaggtggacgtctcggccggcaacggcgcagggagcgtacagagggtggagatcctggagggccgcaccgagtgtgtgctgag caacctgcggggccggacgcgctacaccttcgccgtccgcgcgcgtatggctgagccgagcttcggcggcttctggagcgcctggtcg gagcctgtgtcgctgctgacgcctagcgacctggaccccctcatcctgacgctctccctcatcctcgtggtcatcctggtgctgctgaccgtg…