Which of the following could represent an epigenetic modification in a cell?   A. Deletion of chromosome 18   B. Acetylation of histone H3   C. Deletion of a 20-nucleotide segment of chromosome 3   D. Conversion of an A to a T within a gene   E. Duplication of chromosome 13

Q: Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and 2 are…

A: Introduction :- Exons are the coding regions of an RNA transcript or the DNA that codes for it that…

Q: Which of the following mutations could be appropriately describedas a position effect?A. A point…

A: The mutation is caused due to alteration occurred in the gene sequence due to either environmental…

Q: a way in which proto-oncogenes can change to become genes that induce cancer?

A: A proto-oncogene is a normal gene that can turn into an oncogene due to mutations or increased…

Q: In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR…

A: Mutations are the changes in the DNA sequence, the base sequence of the DNA changes. Mutations can…

Q: transcriptional repressor leading to decreased gene expression. a. chromatin remodelling complex…

A: Transcriptional repressors are the molecules that block/inhibit gene expression. They directly act…

Q: Suggest a direct experiment to prove that p53 binding at gene promoters affects the level of gene…

A: p53 is a protein responsible for tumor suppression and helps in regulation of the overgrowth of…

Q: Which of the following statements is NOT true about chromatin architecture? A. The histone tails on…

A: The DNA is the genetic material of the cell which is responsible for the functions a cell performs.…

Q: expression of recombinant proteins in yeast is an important tool for biotechnology companies that…

A: The gene of interest is taken out from one group of organisms and inserted into the host cell of a…

Q: What degree of differences would you expect to see in the DNA base sequences and epigenetic marks of…

A: Monozygotic twins are born due to splitting of one single fertilized egg into two embryos. They are…

Q: The key to epigenetic regulation is ________.   a. controlling accessibility to transcription…

A: Epigenetic regulation of a gene is the interaction by which the activity of a specific quality is…

Q: HDAC's are important enzymes involved in the regulation of Gene expression. This is because a. They…

A: HAT stands for Histone acetylase. HDAC stands for Histone Deacetylase.

Q: Which statement(s) below regarding DNA mutations is true: A. Mutations only occur in genes B.…

A: Ans: D) Mutation can occur in promoters.   Mutation is a change in the sequence of DNA due to…

Q: Transcriptional activation of eukaryotic genes involves which of the following events? a. Changes in…

A: Nucleosome is the packaging unit in eukaryotes. It is a fundamental subunit of chromatin.…

Q: What are two reasons that a eukaryotic gene (e.g. Green Fluorescent Protein in jellyfish) will not…

A: An eukaryotic gene is a segment of DNA that encodes the information needed to produce a functional…

Q: A genon wide analyst of human genome indicated that approximately 1500 genes encoded transcription…

A: Transcription factors These are proteins that are involved in the process of transcribing the…

Q: Sickle cell disease is caused by a substitution in the beta globin gene. As a result, one amino acid…

A: Normal RBC is a biconcave disc shape structure without any nucleus and have Cytoplasm that possess…

Q: You are investigating the transport of proteins into the ER in various mutant cells. Where would you…

A: Transport into the endoplasmic reticulum (ER) is the important step inside the biosynthesis of…

Q: Cancer cells removed from a patient's tumor have increased gene expression of several hundred genes…

A: Cancer  Cancer if a kind of disorder which caused by several means like drug, radiation, malfunction…

Q: CpG is an epigenetic term which means: Select one: a. The binding of cytosine with the following…

A: DNA is the genetic material of almost all living organisms. It is made up of monomers of…

Q: Transcriptional regulation often involves a regulatory protein that binds to a segment of DNA and a…

A: The process involved in regulating copying of instruction from the DNA into RNA is called…

Q: _____ is the combination of a seat, elation, another modifications to the histones that allow for…

A: Epigenetics is the study of stable phenotypic changes which do not involve alterations in DNA…

Q: Which of the following are examples of molecular changes thatcan have an epigenetic effect on gene…

A: Epigenetic effects are such changes that bring about changes in the phenotypic expression of a gene…

Q: Which of the following is true of CpG islands? a. They are methylated near promoters of actively…

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains. It coils around each…

Q: Would the viral insertion of a proto-oncogene into a region of genomic DNA with non-acetylated…

A: Acetylation reduces the affinity between histones and DNA by removing positive charges. Thus,…

Q: You identify a disease of epidermal cells in mice in which Gene A is not expressed. Further analysis…

A: Gene is the sequence of the genome that codes for a functional protein. The expression of genes from…

Q: Which of the following makes alternative RNA splicing possible? Group of answer choices A. Parts of…

A: Option A

Q: Studies on monkeys have provided insight on the role of maternal care on the epigenome. Imagine you…

A: The study to examine the role of epigenetics in shaping animal / human behaviour is called as…

Q: What have epigenetic monozygotic twin studies proven? A. Twins have identical epigenomes because…

A: The term epigenetics means something that occurs due to a non-genetic influence on the expression of…

Q: In studies on chromatin it has been reported that DNA that is being actively transcribed is more…

A: DNA- “deoxyribonucleic acid” is a complex structure that carries the unique genetic code of every…

Q: Which of the following decrease gene activity? a. acetylation of histone proteins b. methylation of…

A: Epigenetic modifications are heritable changes in gene expression that occur without changing the…

Q: Pax-6 is a gene that is involved in eye formation in many invertebrates, such as Drosophila. Pax-6…

A: Genes are the units of heredity, in other words, we can say genes are the short nucleotide sequences…

Q: How does chemical modification of the histones lead to changes in chromatin structure? Choose all…

A: Chromatin It refers to the complex of DNA and proteins that forms chromosomes in the nucleus of…

Q: Which of the following activities DOES NOT happen during the initiation stage of transcription? A.…

A: Introduction :- The poly-A tail is a stretch of adenine nucleotides that is added to the 3' end of a…

Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…

A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…

Q: Methylated cytosines

A: Answer: