Control of gene expression in eukaryotic cells occurs at which level(s)? Lütfen birini seçin: O a. epigenetic and transcriptional levels O b. post-transcriptional, translational, and post-translational levels O c. only the transcriptional level O d. epigenetic, transcriptional, post-transcriptional, translational, and post-translational levels O e. epigenetic, transcriptional, and translational levels
Q: Suppose a gain-of-function mutation happens in an oncogene. Which of the following changes is likely…
A: Cancer causing gene is known as oncogenes and its an abnormal active gene which promotes growth of…
Q: D D Intron +1 E E A В В C GGGCGG GCCCAATCT TATAAA Intron -5000 -100 -25 1. What region functions…
A: The transcription is the process of conversion DNA to RNA . DNA stands for dioxy ribonucleic acid…
Q: Why do transcriptional regulators act as dimers or heterodimers rather than monomers when binding to…
A: Genome of an organism, especially of eukaryotes, contain large number of non-coding sequences. In…
Q: Combinatorial control of transcription factors refers to the phenomenon that: O A) small effector…
A: Transcription is the process in which the DNA is converted into mRNA and forms the part of the…
Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…
A: During mutation, there is a change in the overall sequence of the gene, which can result in a change…
Q: A mutation occurs in a gene, resulting in it being expressed at the wrong time during development.…
A: The mutation refers to change the sequence of nucleotide in a gene.
Q: a piece of DNA is produced with 1) an enhancer from a gene expressed in the liver, 2) a promoter…
A: Given: A piece of DNA is produced with 1) an enhancer from a gene expressed in the liver, 2) a…
Q: What would the direct consequence to a cell be if there was a loss of function of Transcription…
A: Transcription is the process in which the DNA is transcribed into an mRNA. There are three basic…
Q: Can you please do questions 17,18 and 19
A: We are authorized to answer one question at a time, since you have asked three questions, so we are…
Q: Epigenetic control of gene expressiona. is hereditary. c. adds methyl groups to cytosine.b. locks…
A: Stem cells are cells that can grow not other cells in the body. Stem cells are of two types one is…
Q: Genes are transcribed in specific cells during the embryo and adult body. The ability of a given…
A: Transcription factors and growth factors control the process of cellular differentiation and result…
Q: Which of the following mechanisms may be involved when PRC1complexes silence gene expression?a. The…
A: The process of genic expression is used to direct the assembled protein molecule with the encoded…
Q: Combinatorial control refers to the phenomenon that a. transcription factors always combine with…
A: Among the given options, option(b) is the most appropriate."Combinatorial control refers to the…
Q: How is transcription directly controlled in eukaryotic cells? a. through the use of phosphorylation…
A: Transcription refers to a process that transcribes the DNA molecule into a molecule called RNA which…
Q: The “domain-swapping” experiment that grafts the Gal4 DNA-binding domain to the LexA activation…
A: The ans is option C.
Q: Chaperone proteins interact with the polypeptide sequence formed in translation. How might a mutant…
A: Chaperone proteins are the molecular machinery that helps in proper folding of the proteins and also…
Q: Examining the DNA of a cancerous cell, a scientist would find strong expression of A. siRNAs. B.…
A: Option c i.e. oncogenes is the correct statement for the above question.
Q: Prostate cells usually require testosterone and other androgens to survive. But some prostate cancer…
A: Prostate cells usually require testosterone and other androgens to survive. But some prostate cancer…
Q: The functioning of enhancers is an example of(A) a eukaryotic equivalent of prokaryotic promoter…
A: Enhancer refers to a short region of DNA. It increases the process of transcription of a particular…
Q: How does reverse methylation affect gene expression? Select one: o a. The gene is turned off, but…
A: Hello. Since your question has multiple parts, we will solve first question for you. If you want…
Q: Expression of a gene, in terms of greater accumulation of the protein it encodes, could be increased…
A: Often biomolecules like protein are produced in our body for any bodily functions. They are specific…
Q: Based on the labels you should be able to recognize the characteristic structure depicted below and…
A: Introduction The Process Of Turning Nucleic Acid Information Into Amino Acids Is Known As…
Q: Based on my your observations, describe the role of the transcription factors and the regulatory…
A: Central dogma involves a method where RNA formed from DNA , and DNA shows heterocatalytic neture,…
Q: Suppose MYC regulates gene X by recruiting DNA methyltransferases (DNMTS). Which of the following…
A: cis regulatory elements are regions of non coding DNA which regulate transcription of neighbouring…
Q: How is the splicing of U2-dependent introns different from that of U12-dependent introns? O a.…
A: The non-coding sequences are called introns and hence are needed to be removed from RNA. This is…
Q: A signaling pathway causes a transcription factor binding to a particular promoter. What effect does…
A: Answer- Signaling transduction is the process by which any specific external physical or chemical…
Q: Can one transcription factor sometimes act as a repressor and sometimes act as an activator? O a.…
A: We are authorized to answer only one question at a time, since you have not mentioned which question…
Q: Transcriptional enhancers are: O A operator sequences that repress transcription by blocking RNA…
A: Transcription is the mechanism by which an RNA duplicate of a gene arrangement is created. This…
Q: Which level of gene regulation is involved when alternative sigma factors change the recognition of…
A: Alternative sigma factor in association with core RNA polymerase provide a mechanism of cellular…
Q: does reverse methylation affect gene expression? Select one O a The gene is tumed off, but stl…
A: Gene expression is the process by which the instructions in our DNA are converted into a functional…
Q: Hac1 is another chaperone protein that is up-regulated in response to unfolded proteins in the ER.…
A: Introduction Proteins are essential biomolecules that play a wide range of roles in controlling…
Q: Select the incorrect statement: OA Transcription produces an MRNA of a gene that leaves the nucleus.…
A: a. We know that genes or DNA are kept in the nucleus. Ribosomes are present outside the nucleus,…
Q: Label these processes 1-8 (1 being the earliest time point) in the order they would occur during…
A: DNA is the molecule which stores the genetic information. Genetic information in the DNA is first…
Q: Differential gene expression describes how... (Choose the answer the best illustrates the definition…
A: The expression of genes in for transcription that is the production of RNA from DNA. After the RNA…
Q: you think the process could be regulated? Select all that apply: a) Before transcription begins.…
A: Gene expression is the process by which information from a gene is synthesised. The synthesis of a…
Q: Many genes whose expression is turned on by DNAdamage have been isolated. Loss-of-function mutations…
A: The lex A gene encodes a repressor protein and is involved in controlling the DNA repair, inhibition…
Q: The recruitment of Histone deacetylase (HDACS).... O a. Enzymatically adds acetyl groups to E2f…
A: Histone deacetylase (HDACs) are enzymes that remove acetyl group from histone proteins on DNA. It…
Q: The extent to which a given gene is transcribed depends upon (A the single transcription factor…
A: Transcription is a process where DNA converted into a mRNA. It has three step initiation, elongation…
Q: 1. Draw a simplified model of a cis-regulatory element with multiple trans-acting factors…
A: A double-stranded DNA contains two regions, coding and non-coding. The non-coding region contains…
Q: How does the 4 feature of transcription factors namely the structural motifs of DNA binding protein,…
A: Transcription: It is the process of synthesis of mRNA transcript from the double-strand DNA by the…
Q: la) The MRNA transcript encoded by a gene called TLR4 has 3 EJCS (Exon Junction Complexes) bound to…
A: A gene is expressed through the processes of transcription and translation and involve many…
Q: How does epigenetic regulation differ from other forms of gene regulation? O It is easily…
A: Unlike genetic changes, epigenetic changes are reversible and do not change your DNA sequence, but…
Q: Which of the following is NOT a mechanism of control of gene expression Group of answer choices a.…
A: The regulation of gene expression is controlled by various methods that includes control of…
Q: ccording to the histone-code hypothesis, what is one way that cell specialization occurs? a)…
A: Histone code hypothesis : It was proposed by Strahl and Allis . Multiple histone modifications ,…
Q: Define both transcription and translation. In addition, describe the role(s) of each of the…
A: The two main steps involved in protein synthesis are transcription and translation. These two…
Q: At which stage of the Central Dogma does MOST of the regulation of gene expression occur? O…
A: * central dogma is the conversion of Dna into proteins was discovered by Francis Crick. *According…
Q: 1. Where would the RNA polymerase II bind this piece of DNA = region B 2. What DNA sequence would…
A: 1. DNA polymerase 2 binds with the piece of DNA - B & A. Explanation - Region B is the - 80 CAAT…
Q: A DNA mutation in which of the following part of a gene is likely to be most damaging to…
A: It is a multiple choice question.
Q: Different cell types, for example a muscle or a blood cell in the same organism retain O only a…
A: The production of RNA from the DNA is known as gene expression. This process is known as…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repairE VG ✓H NA MATEN Match each letter (A through G) to its description. B A ya pada saat ada para a H F காலிமாம்ம் P S —— 1. Receptor 2. RNA 3. Lysosome 4. DNA 5. Ribosome 6. Ligand 7. Kinase domain 8. Nucleus 9. Mitochondria 10. Phosphorylated transcription factor 11. Dephosphorylated transcription factor 12. Plasma membraneA signaling pathway causes a transcription factor binding to a particular promoter. What effect does this have on the cell? O A. The DNA region near the promoter becomes more methylated. O B. The DNA region near the promoter becomes less methylated. O C. The gene related to this promoter has increased transcription. D. The gene related to this promoter has decreased transcription. red MacBook Air 吕口 F3 D00 F4 F6 F7 F8 88 # $ % & * 2 3 4 6 7 8
- g protein D. Growth factor receptor ng Tool 0 Q ing C. Growth factor-binding protein D. Growth factor receptor E. Transcription activator A child with retinoblastoma is found to have a 13q14 deletion. The Rb gene, which resides at this locus, produces which kind of tumor-associated protein? A. Cell cycle regulator B. Growth factor ㅂ분 요 9 12 W □ @ 2 C Edit in Paint 8 60 8 FocusSuppose hemoglobin is inhibited at the post-translational level. This means is it regulated at the _____ Select one: a. DNA level and mRNA will not be made b. tRNA level and protein will not be made c. mRNA level and the protein will not be made d. protein level and it will be inactive e. precursor mRNA level and mature mRNA will not be madeIf a gene is mutated, then it may consequently affect the expressed in the central dogma which then may lead to alter the production/function of other bio-molecules. Select one: a. lipids b. carbohydrate С. DNA Ca d. protein Do Is w Wha ( Previous page Next page https:// Jump to... What Mar 13. These m https://bic 2.2A: V MacBook Pro esc n m-wanry ur @ # $ % & 1 2 3 4 6 Q W E Y tab А S D F G caps lock
- What mRNA is transcribed from each DNA sequen а. 5'-GTTCTAС-3' 3'- -5' b. 5'-ATTTGAAA-3' 3'- -5' c. 5'-GCCTAAGGCT-3' 3'- -5' d. 5'-CGCGCTTTGTG-3' 3'- -5'Cohesin proteins function as Select one: and are most likely degraded during the early steps of a. motor proteins, S phase O b. structural proteins, S phase O c. enzymes, S phase O d. enzymes, anaphase e. structural proteins, anaphase e Dec 8 at 5pm Jump to... NexI. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…
- Would the cell likely experience an issue due to the incorrect function of the protein produced by the following mutations? Why or why not? DNA 5' GCGATGCCCTAGGTATGA 3' normal с G a. DNA 5 GCGATGGCCTAGGTATGA 3' mutant b. DNA 5 GAGATGCCCTAGGTATGA 3' mutant c. DNA 5 GCGATGCCATAGGTATGA 3' mutant U UUU Phenylalanine UUC Phenylalanine UUA Leucine UUG Leucine CUU Leucine CUC Leucine CUA Leucine CUG Leucine AUU Isoleucine AUC Isoleucine AUA Isoleucine AUG Methionine (Start) GUU Valine. GUC Valine GUA Valine GUG Valine с UCU Serine UCC Serine UCA Serine UCG Serine CCU Proline CAU Histidine CCC Proline CAC Histidine CCA Proline CAA Glutamine CCG Proline CAG Glutamine ACU Threonine AAU Asparagine. ACC Threonine AAC Asparagine ACA Threonine AAA Lysine ACG Threonine AAG Lysine GCU Alanine. GCC Alanine GCA Alanine GCG Alanine. A UAU Tyrosine UAC Tyrosine UAA Stop UAG Stop GAU Aspartic Acid GAC Aspartic Acid GAA Glutamic Acid GAG Glutamic Acid G UGU Cysteine UGC Cysteine UGA Stop UGG CGU CGC…of gene. 12. Steroid hormone receptor complex binds to the A. transcription start site B. promoter region C. coding sequences D. poly-A sequence E. untranslated regionsYou study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAA! AAGCTCGAGAGCAGCAGCTСТАTGCGCTAСТАТААТGACСАТТАТАССССТАСGTGATAG 3' СTGGIAATATOGGGATGCACTАТС 5' RNA promoter polymerase Practice Question 4 F) You also study the expression of different mutants for this gene. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above). For mutant B answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter m in…