Q: The cancer type that is the fourth biggest killer in the US for both men and women Pancreatic Liver…
A: Cancer is a complex disease that is caused by genetic mutations that interfere with normal cell…
Q: Spontaneous change is a change that continues on its own once it has started. True False
A: Defination -A Spontaneous change is change that occurs on its own without any input from outside.…
Q: question 2. To detect trisomy 18 in amniotic fluid cells the most optimal probe type to use is A)…
A: Trisomy 18, also known as Edwards syndrome, is a genetic disorder that is caused by the presence of…
Q: Fill in the blanks with the numerical answer only: Number of electrons generated in oxidation of 1…
A: Introduction Cellular respiration is the process by which cells convert nutrients (such as glucose…
Q: Identify and briefly describe the significant physical and physiological changes that occur in the…
A: Changes during middle childhood : The rate of a child's physical growth slows down when they…
Q: How can you determine that a gene sequence codes for NLS?
A: A gene is a fundamental unit of heredity that carries the genetic information required for the…
Q: The electron transport train relies on electron carriers NADH and FADH2 to function normally. An…
A: Introduction :- The electron transport chain (ETC) is a series of protein complexes and electron…
Q: 3. In humans, brown eye colour (B), is dominant over blue eye colour (b). a. What are the phenotypes…
A: Alleles are the alternative form of a gene that are located on the same locus of the homologous…
Q: Discuss in detail the data of the current uk public helath statergies in tackling type 2 diabetes.…
A: Introduction Type 2 diabetes is a chronic metabolic disorder that affects how the body processes…
Q: The pattern of most hormone secretion is described as? Please explain
A: The glands, like the pineal gland or the paracrine gland, produces hormones, which are signalling…
Q: Infer why one organ would need two different types of glucose transporters
A: Glucose transport refers to the process by which glucose, a simple sugar and the primary energy…
Q: STUDY QUESTIONS The table below presents the criteria to be used in comparing mitosis and meiosis.…
A: Introduction:- Mitosis is a cell division type that occurs in somatic (body) cells to produce two…
Q: The reaction mechanism of alpha-amylase going through a Nelson Somagyi Assay. (please draw the…
A: The fact that enzymes are very selective and can only catalyze certain reactions contributes to the…
Q: Please put the following steps of immune activation in order. ✓ The pathogen is eliminated. Multiple…
A: The immune system is described as the defense system of the body that protects the body from the…
Q: 21. Cell Transport Task Cards Station #13 13. The diagram represents the active transport Station #1…
A: INTRODUCTION:- The membrane or covering outside the protoplasm in both prokaryotic and…
Q: Contrast the reactions that build muscle to the reactions that break meat down. How are…
A: Introduction :- Macromolecules are large molecules that are made up of smaller subunits called…
Q: What enzymes methylate DNA? How are these two enzymes different? For methylation to be heritable…
A: Introduction :- DNA methylation is a process in which a methyl group (-CH3) is added to a cytosine…
Q: Visually compare the intensity of your team’s Plant-DNA sample with the intensity of the 3 kb band…
A:
Q: What do you think helped Homo sapiens thrive and populate the world? explain
A: Homo sapiens is the scientific name for the modern human species, which is the only surviving member…
Q: ERVATIONS: What is the shape of the skeletal muscle fibers? 2. Draw and label the parts of the…
A: All cells possess the activity of contractility and motility that results from the interaction of…
Q: Genotype A₁A₁ A₁A₂ A₂A₂ Survival (1) Reproduction (m) 0.8 0.8 0.9 20 150 90 W The case of selection…
A:
Q: describe the shape of the colony of the Volvox. Label the individual cells and the daughter…
A: In Volvox, the daughter and parent colonies can be differentiated on the basis of their color and…
Q: Some classmates are discussing arguments in favor and against eating meat. A classmate makes the…
A: Introduction A species is a basic unit of biological classification that refers to a group of…
Q: A victim of a severe shock may suffer internal hemorrhages and destruction of tissues, nerves, and…
A: Hemorrhage refers to the escape or loss of blood from the circulatory system due to a ruptured blood…
Q: Which of the following statements BEST describes how the DNA interacts with the nucleosome? Selected…
A: Eukaryotic DNA remain associated with histone proteins which is a positively charged basic amino…
Q: Presence of antibody that is not absorbed by guinea pig kidney cells but is by beef rbc's. If…
A: These are the special kind of antibodies that react with horse, Ox, sheep, beef RBC. Beef RBC can…
Q: 100 100 5) Use the following phylogeny to answer the questions below. The numbers on the branches…
A: Based on this phylogeny, 6 clades are present within the ingroup of in which pampus fox belongs to.
Q: Which stage of succession has the strongest interspecific competition? First stage of succession or…
A: Succession refers to the process by which the structure and composition of a biological community…
Q: You digested genomic dna with two restriction enzymes, Hinf I and Rsa I. These enzymes are used…
A: Restriction enzymes, also known as restriction endonucleases, are enzymes that recognize specific…
Q: How do mineral oil and gylcerol preserve microbial culture
A: Microbes are microscopic organism which cannot be seen through naked eyes but require microscope for…
Q: Give written answer with explanation and conclusion Prior to mitosis, thin strands if DNA in the…
A: Cell division is the process by which a parent cell divides into two or more daughter cells. It is…
Q: Calculate the amount of BSA you will add to the tube to get the concentrations listed on the chart.…
A: BSA stands for Bovine Serum Albumin, which is a protein commonly used as a standard or reference in…
Q: Contrast the movement of chyme in the small intestine vs. a bolus in the esophagus.
A: Introduction :- Chyme is a thick, semifluid mixture of partially digested food and gastric juice…
Q: How can we use dihybrid cross in understanding Mendelian genetics?
A: Introduction :- A dihybrid cross is a genetic cross that examines the inheritance of two different…
Q: Students are building a model of the cell membrane. They are demonstrating how the cell membrane…
A: The cell membrane is a selectively permeable barrier that surrounds the contents of a cell and…
Q: All of the following at side effects of Testosterone use EXCEPT a. Infertility. b. Excessive hair…
A: Testosterone: Testosterone is a hormone that is mainly produced in the testicles in males and in…
Q: Which change would most likely increase the amount of energy that can be stored in ATP? a) The…
A: Cellular metabolism is a phenomenon takes place inside the living organism in which new materials…
Q: B. IODINE (IKI) TEST FOR STARCH Pos or Neg Control 1 2 Control/Standard 1 2 Sample 3 Distilled Water…
A: Introduction: Standard solutions are used for several purposes in various fields, including…
Q: A temperature-sensitive mutant yeast strain stops dividing when shifted from 25°C to 37°C. These…
A: According to our guideline we can answer only the first question (upto first three subparts). So,…
Q: What stage of succession would you expect the highest animal diversity? Explain whyY? Explain…
A: Animal Diversity: Animal diversity refers to the variety of different species of animals found on…
Q: 1. Draw and label the visible parts of the different types of epithellal and function below your…
A: Epithelial tissue is a type of tissue which form lining around the body cavity and organ . Types :-…
Q: < Previous Submit Test O 02.CI.Biology.CRM3.2_2023 A scientist discovered a new organic molecule…
A: Introduction A cell is the basic unit of life and the smallest living component of any organism. It…
Q: How do flatworms accomplish gas exchange (obtain oxygen and get rid of carbon dioxide)? What…
A: Flatworms: Flatworms, also known as Platyhelminthes, are a group of soft-bodied invertebrate…
Q: The enzyme, fumarate, has the following kinetic constants: k 1 k 2 k -1 where k 1 = 10 9 M -1 s -1 k…
A: Introduction :- Enzymes are proteins that catalyze (speed up) chemical reactions in living organisms…
Q: What type of moth pollinates columbines? Give typing answer with explanation and conclusion
A: columbines: Columbines (Aquilegia spp.) are a group of herbaceous perennial plants that belong to…
Q: If you lived in the Greek world during the sixth century B.C.E. and knew only what could be known at…
A: Anaximenes and Thales were ancient Greek philosophers who lived in the 6th century BCE. Thales is…
Q: Cleavage... A. Is a developmental stage consisting of a cell layer surrounding a fluid-filled space…
A: Fertilization is the process by which the sperm and the egg combine to form a zygote, which is the…
Q: Is the mature Sargassum haploid or diploid?
A: Introduction :- Haploid refers to a cell or organism that has only one set of chromosomes. In other…
Q: Give the names of 2 tissue parasites 2. Briefly describe methods by which tissues parasite can be…
A: A parasite is a living thing which inhabits its host and feeds off of or at the cost of it.…
Q: Match each term with the most appropriate description. Each answer may be used only once. <…
A: Introduction: Redox reactions play an important role in many areas of science, including…
which individual has the shortest telomeres?
Step by step
Solved in 2 steps
- 1/V (uM x min-1)-1 1. To the right is a Lineweaver-Burk plot for an enzyme that can cleave both DNA (D) and RNA (R). 2200 2000 1800 a. What is the KM when cleaving DNA? I 1/V R 1600 • 1/V D b. What is the KM when cleaving RNA? 1400 1200 C. What is the Vmax when cleaving DNA? Z 1000 800 d. What is the Vmax when cleaving RNA? 600 e. On the graph, draw an appropriate line for a 400 noncompetitive inhibitor for cleaving DNA. Label clearly. f. On the graph, draw an appropriate line for an uncompetitive inhibitor for cleaving RNA. Label clearly. 200 8 10 11 1/S (µM)-1Cap, EA1, and Sap are all genes/proteins of interest in this study. For each gene, what gene product is encoded and where is the gene (the literal DNA sequence) located physically in the cell? I need help fimiding this in the artticle and answer as short as possible https://www.ncbi.nlm.nih.gov/pmc/articles/PMC106848/Answer the following: 1. Which pieces of DNA are the most informative? Why? 2. Explore the concept of "depth of coverage" (the number of fragments that cover a particular span of the contig). Where is the greatest depth of coverage? Where is the least depth of coverage? 3. What do the patterned bands represent? 4. Was it easier to assemble fragments that had multiple types of markers vs. just one type? Why? Assembling contigs out of DNA sequences (strings of As, Cs, Gs, and Ts) follows the same principle: instead of using markers, you line up fragments by overlapping DNA sequences.
- AaBbCcDdE AABBCCDDE AaBbCcDc AaBbCcDdEe v A v Normal No Spacing Heading 1 Heading 2 Activity 4 You isolate a bunch of different mutants, all in the same gene, that effects body length in your model genetic organism. You have organized your observations in the table below. Wild type length Length of heterozygotes Length of homozygotes Mutant 1 2 cm 1.5 cm 1 cm Mutant 2 2 cm 1 cm 1 cm Mutant 3 2 cm 1.5 cm 1 cm Mutant 4 2 cm 2 cm 1 cm 1. Which of the above is a recessive mutation? 2. Which of the above is a Dominant mutation? 3. Mutants 1 and 3 have very similar results, but there are 2 types of dominate mutations that can cause this? What are they and how will you distinguish between them? stv Ps X w 888 DII DD F4 F5 F6 F7 F8 F9 F10 % & * ) 5 6 7 8 9DNA GAAGGGACAATACTTTCTTAACACTTG MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis? Conclusion Questions: 1. Examine the protein you created. If the DNA strand that you started with had a change in it (A changed to G), what would happen to the protein made?Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome 1. a discrete part of a protein that provides a unitof functionb. de novo gene 2. a nonfunctional member of a gene familyc. gene desert 3. the joining together of exons in a gene indifferent combinationsd. pseudogene 4. most frequent residues, either nucleotide oramino acid, found at each position in asequence alignmente. syntenic block 5. set of genes related by processes ofduplication and divergencef. orthologs 6. chromosomal region with the same genes inthe same order in two different speciesg. naturalselection7. genes with sequence similarities in twodifferent species that arose from a commonancestral geneh. consensussequence8. genes that arose by duplication within aspeciesi. gene family 9. genomic DNA sequences containing exonsj. paralogs 10. gene-poor region of the genomek. alternativeRNA splicing11. recently evolved from intergenic DNAsequencesl. protein domain 12. progressive…
- D Question 23 What is predictive DNA Phenotyping? O a method using known phenotypes to predict a suspect's DNA profile an STR profile a method using DNA sequence information to predict identifying phenotypes O a genotypic profile based on combined mitochondrial and Y-chromosome STR genotypes Question 24Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the polarity of the two DNA strands. Analyse this DNA fragment and answer the questions 1-5 that follow. +1 -10 -35 3' TTGCATCCGAAACGTACGATCGATESGCCGACTTATTACGATCGGACTACTGCGTCGTAGC5' 5' AACGTAGGCTTTGCATGCTAGCTAGCCGGCTGAATAATGCTAGCCTGATCACGCAGCATCG3' ... ... Provide a brief statement in the space provided 1. What is the name if the TATTA sequence at -10 ? 2. What is the purpose of the -10 and -35 sites 3. What do you understand by the +1 site 4. Write the letters for the bases of the first 6 nucleotides of the mRNA molecule transcribed from this gene. Indicate the 5' and 3' end in your answer1) Do you agree or disagree with this statement? Transposons can cause genomic rearrangements or genomic expansion compared to microsats, which are only associated with genomic expansion. Explain your response. 2) Do you agree or disagree with this statement? Since bone is a non-living structure, it would not be useful for genomic profiling. Explain.
- Demuestra lo que sabes del vo X ure.com/courses/57129/quizzes/206819/take Question I8 1 pts 3.7- Chargaff's Rule & The Hayflick Limit In 1950, Erwin Chargaff analyzed the base pair composition of DNA. He discovered that... % Adenine = % Thymine % Cytosine = % Guanine Meaning... There are equal amounts of Adenine and Thymine and equal amounts of Cytosine and Guanine in any given DNA sample. Question: Which of these statements is TRUE if there is 40% Guanine in a strand of DNA? There is 20% Adenine O There is 15% Thymine O There is 10% Cytocine O There is 10% AdenineIn a cotransduction experiment involving P1, the cotransductionfrequency was 0.53. How far apart are the two genes?A: Lambda DNA/Hindlll Marker, 2 B: GeneRuler" 1 kb DNA Ladder tp no0.5 O'GeneRuler" 1 kb DNA Ladder, ready-to-use bp ng/0.5 pg 23130 2384 07 W1 19.4 676 13.5 4961 450 9416 6557 9.0 564 5.8 1500 25.0 5.0 12 750 1000 60.0 12.0 25.0 5.0 125 13 0.3 500 25.0 5.0 250 25.0 5.0 0.5pon, Bom lngth g 1XTAE, 7Vom 45 mi Range 8 fragments on bp: 23130, 9416, 6557, 4361 2322, 2027,.564, 125 0.5 pgtne, 8 cm kength gel IIXTAE, 7VRm 45 min Which ladder would be the BEST to use if you had a sample that should measure both 1010 bp and 2027 bp? Tapito" LE GO Agune (RO1)