When DNA is heated, it denatures; that is, the strands separate because hydrogen bonds are broken and some base-stacking and hydrophobic interactions are disrupted. The higher the temperature, the larger the number of hydrogen bonds that are broken. After reviewing DNA base pair structure, determine which of the following molecules will denature first as the temperature is raised. Explain your reasoning. a. 5′-GCATTTCGGCGCGTTA-3′ 3′-CGTAAAGCCGCGCAAT-5′ b. 5′-ATTGCGCTTATATGCT-3′ 3′-TAACGCGAATATACGA-5′

If you analyze a double-stranded DNA molecule and find that 15% of all the nucleotide bases are Adenines, you know that there must also be [ Select ] Thymines, [ Select ] Guanines, [ Select ] v Cytosines and [ Select ] Uracils. (Count each of the bases in any double stranded DNA molecule and calculate their percentages to find the simple key for this if you haven't seen it yet.)

The figure shows that the average distance between base pairs measured parallel to the axis of a DNA molecule is 3.4 Å. The average molar mass of a pair of nucleotides is 650 g•mol-1. Estimate the length in cm of a DNA molecule of molar mass 5.1x109 g•mol-1. 4.0 cm Roughly how many base pairs are contained in this molecule? 4.0 7.1e6 X base pairs AT CG OH O-P=D0 G C TA Adenine Thymine OH CH2 N-H.......O CH3 H -N N..... G C H A Он C G G C TA AT OH CH2 Cytosine Guanine H. O.......H-N H H' H N…**H-N HLH O N-H..... H2C OH TA OH CH2 (b) The most common structure of DNA, which is a right-handed double helix. The two strands are held together by hydrogen bonds and other intermolecular forces. (a) Base-pair formation between adenine (A) and thymine (T) and between cytosine (C) and guanine (G).

DNA structure depends on base pairing of its four nucleotides, A, C, T, and G. Nucleotide A pairs with T, and nucleotide C pairs with G. This forms a four-letter DNA “alphabet." Because DNA codes for amino acids in sets of three nucleotides, there are 4 cubed (4'), or 64, possible combinations, coding for 20 different amino acids. What is the best explanation for why there is no selective advantage for DNA to have five nucleotides (e.g., A, C, T, G, and E) with C pairing with either G or functionally equivalent E? It would be impossible to form the DNA molecule, because it must have an equal number of Cs and Gs. Because G and E have the same role, there would still be four functional letters of the alphabet. Replication would be inaccurate because sometimes C would bond with G and sometimes C would bond with E. There would be a five-letter alphabet with 125 combinations, which is too numerous. It is impossible because there are not five known nucleotides in the cell.

If a DNA double helix contains 28% T nucleotides, then what is the percentage of A nucleotides?

The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?

The Tm of a DNA strand can be calculated by hand using the formula:           (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃   Using this formular, calculate the Tm for the following DNA sequence:                       [CTTTCACAGCCACTATCCAGCGGTAC]   Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.

Assume that the molar percentage of thymine in a double stranded DNA is 20. What are the percentages of the four bases (G, C, T, A)? b. The base content of a sample of DNA is as follows: A=31% G=31% T=19% C=19%. What conclusion can be drawn from this information?

It is known    that    double    stranded    DNA    is    denatured    at    low    pH.     pKa values    should    allow    the    determination    of    whether    this    is    due    to    perturbation    of    the    hydrogen    bonding    in    A-T    and/or    G-C    base    pairs.    The    table    gives    values    for    the    pKas    of different    protonated    groups    in    the    nucleobases.Nucleobase Position    &    pKa                    A             N1,            3.5                    G             N7,            1.6;                N1,    9.2                    C             N3,        4.2                    T             N3,        9.7a)   Draw    the    A-T    and    G-C    base    pairs.                - Label    the    bases    with    the    one-letter    code.    –        - Number    the    atoms    in    the    rings and    label    the    atom    that    attaches    to    the    sugar.                - Mark the groups that interact in normal…

The figure shows that the average distance between base pairs measured parallel to the axis of a DNA molecule is 3.4 Å. The average molar mass of a pair of nucleotides is 650 g•mol-1. Estimate the length in cm of a DNA molecule of molar mass 5.1x109 4.0 .26 g•mol-1. cm Roughly how many base pairs are contained in this molecule? [4.0 784615 x base pairs CG G C OH TA Thymine Adenine H. H. OH CH2 N-H.......O CH3 H H N……·H–N HLH TA OH 0-P H2C CG G C H. CH2 Guanine H OH Cytosine ... H-N TA AT H' N.....H-N HLH N-H.......O H2C OH H -o. -P3D0 TA 0- OH H. -CH2 (b) The most common structure of DNA, which is a right-handed double helix. The two strands are held together by hydrogen bonds (a) Base-pair formation between adenine (A) and thymine (T) and between cytosine (C) and guanine (G). and other intermolecular forces.