What is the first step in protein synthesis? A. making an RNA copy of the DNA within the nucleus

Q: What is the role of transcription in the determination of the amino acid sequence of a polypeptide…

A: Transcription is the initial stage in gene expression, when information from a gene is used to build…

Q: what are the sequence of events involved in protein synthesis. describe what occurs in each step

A: Protein synthesis or translational: It is the process in which proteins are synthesized by…

Q: Which amino acid sidechain can readily donate or accept a proton at near physiological pH?    a.…

A: Proline side chain is not ionizable and hence has no pKa. pKa of lysine side chain is 10.53. pKa of…

Q: DNA is a chemical that cells use to store information. Describe how information is encoded in DNA,…

A: DNA is Deoxyribo Nucleic Acid which is a complex molecule which consists of two polynucleotide…

Q: In order to isolate the DNA or RNA from the cells, what would be the first step? a. to block the…

A:

Q: Examine the diagram carefully, and then answer the question below. VII VII i iv vii VII This diagram…

A: DNA is genetic material which composed of 4 nucleotide ATGC and present in double helix form.

Q: Where does RNA translation into amino acids takes place?  1. Cytoplasm 2. Endoplasmic reticulum…

A: Translation is a process through which mRNA sequence in an encoded form is translated into a…

Q: In protein synthesis, DNA transcription records the genetic message, while ribosomal interprets the…

A: Except for a few viruses, DNA (deoxyribonucleic acid) is the genetic material of all organisms on…

Q: Which is not a function of plasma membrane proteins? a. Recieving signals from outside the cell or…

A: The plasma membrane has the primary function of shielding the cell from its surroundings. Composed…

Q: whtat is the function of seperase

A: The protease is also called proteinase or peptidase is an enzyme that allows protein breakdown into…

Q: What is meant by the term DNA replication? a. synthesis of nucleotides b. cell division c.…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: Where does the first step of protein synthesis occur

A: The answer depends on whether you're talking about eukaryotic cells or prokaryotic cells.Eukaryotic…

Q: Which type of gene controls functions like an "on-off" switch for gene transcription? A. DNA…

A: Option D is the correct answer

Q: Choose the combination of answers that most accurately completes the statement. DNA replication is…

A: Answer- DNA is semiconservative in nature, It was proposed by Francis Crick.

Q: Define the role of ribosomes in protein synthesis

A: Ribosomes are one of the many organelles present in the cell. It is mainly made of rRNA and has two…

Q: Why was the cold ethanol added to the soap and salt mixture?

A: DNA - is Deoxy Ribo Nucleic acid is a hereditary material which contains all the genetic information…

Q: Which statement BEST DESCRIBES the genetic code?   A. There can only be one codon for multiple amino…

A: 3 nucleotides ( triplet ) formed a single codon . Each codon code for specific amino acid . There…

Q: Which enzymes help in DNA replication?

A: The process of synthesizing identical copies of DNA from the original DNA molecules is referred to…

Q: NA contains the information that a cell uses to synthesize a particular protein. How do proteins…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: Which sequence regarding protein synthesis is correct?a. translation → transcription → mRNA…

A: Introduction  A genome is consists of transcriptionally active genes. These genes form mRNA as they…

Q: What three organelles are involved in protein synthesis?Explain it

A: We can say that The amino acids are connected to each other by means of peptide bonds. A peptide…

Q: The first level of DNA organization in a eukaryotic cell is maintained by which molecule? a. cohesin…

A: Eukaryotes are organisms with the cell nucleus enclosed within a nuclear envelope Deoxyribonucleic…

Q: What are the two main stages in protein synthesis?

A: Protein synthesis is one of the most important processes that take place in cells, a single cell in…

Q: describe how the DNA strand will be synthesized into a functional protein.

A: The genes in the genetic material (DNA) of a cell is coded into proteins by two major steps as…

Q: Explain how DNA transcription occurs and what is formed by this process.

A: The central dogma of molecular biology, given by Dr. Francis Crick states that the information…

Q: RNA differs from DNA in that: All are correct ORNA contains ribose. RNA contains uracil ORNA is…

A: RNA stands for Ribonucleic acid. It is a type of nucleic acid that is found in all living cells. RNA…

Q: What is the first step in protein synthesis?

A: The Translation is the second part of the central dogma of molecular biology: RNA Protein : It is…

Q: Where does the transcription of DNA into mRNA occur in eukaryotes?   A. Nucleus   B. tRNA   C.…

A: The gene expression involves the transcription and translation of gene and mRNA (messenger…

Q: Where does translation of mRNA into polypeptides occur? a.Cytoplasm b.Nucleus c.Nuclear pores…

A: Cells are the biological, structural and functional unit of an organism. Cell has a nucleus that…

Q: Make a list of all components necessary for DNA replication; now explain how these components are…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: 5’GCTATAAAGCGTATCGCGTCATA 3

A: Complementary mRNA      5’GCT ATA AAG CGT ATC GCG TCA TA '3     3'CGA UAU UUC GCA UAG CGC AGU AU '5

Q: What are the three phases of creating pre-mRNA? a. Initiation, Elongation and Termination b.…

A: Pre-mRNA, also known as precursor messenger RNA, is the first RNA molecule transcribed from a DNA…

Q: Which sequences are spliced out of the mRNA strand before leaving the nucleus?  In other words,…

A: Answer: TRANSCRIPTION : It is the process in central dogma where a DNA strand is transcribed in to…

Q: How many “letters” of an RNA molecule, in sequence,does it take to provide the code for a single…

A: Ribonucleic acid (RNA) are polymeric organic molecules, which are essential for carrying out various…

Q: How many tRNAs must a cell contain

A: In this question, we have to describe number  of tRNA  must a cell contain.

Q: Choose the combination of answers that most accurately completes the statement. Transfer RNA is the…

A: RNA is a polymer of nucleic acid consisting of four monomeric ribonucleotides. Each ribonucleotide…