Write down some function of Mrna?

Q: what are the sequence of events involved in protein synthesis. describe what occurs in each step

A: Protein synthesis or translational: It is the process in which proteins are synthesized by…

Q: Why would a protein increase mRNA levels? How would you test that to prove your theory?

A: The Central Dogma of Molecular biology states that information is transferred from DNA…

Q: How does a mRNA molecule carry information from DNA?

A: mRNA is a single stranded rna molecule that is complementary to the DNA strands of a gene. mRNA…

Q: Know the relationship between exons and protein domains.

A: Introduction: Nucleic acid coding segments found in mRNA are known as exons. Non-coding segments in…

Q: Distinguish between the introns and exons of a gene.

A: Genetics is a piece of science stressed over the examination of genes, genetic assortment, and…

Q: Which sequence regarding protein synthesis is correct?a. translation → transcription → mRNA…

A: Introduction  A genome is consists of transcriptionally active genes. These genes form mRNA as they…

Q: Describe how the genetic code in DNA specifies the amino acid sequence in a protein.

A: Introduction  Genes are the main regulatory sequence of nucleotides found in the nucleus which…

Q: what is protein sorting ?

A: Protein targeting, according to Gunter Blobel, is based on intrinsic protein properties rather than…

Q: Explain how rRNA is processed.

A: Ribosome biogenesis or the assembly of ribosomes involves more than 200 assembly factors and spreads…

Q: Give typing answer with explanation and conclusion What is a codon?

A: The gene (functional part of DNA that undergoes expression) produce RNA by the transcription process…

Q: Describes an anti-codon?

A: According to Central Dogma :- Genetic instructions are transferred from DNA to RNA and then RNA to…

Q: What happened when a ribosome reaches a stop codon on the mRNA ?

A: DNA is the carrier of genetic information in almost all living organisms except for a few RNA…

Q: Describe transcription, modification with the help of a diagram

A: Transcription is the process by which RNA is synthesized using a DNA template strand. The process is…

Q: illustrates how RNA splicing works?

A: The central dogma involves the transfer of information from DNA to RNA and then to the proteins.…

Q: 5’GCTATAAAGCGTATCGCGTCATA 3

A: Complementary mRNA      5’GCT ATA AAG CGT ATC GCG TCA TA '3     3'CGA UAU UUC GCA UAG CGC AGU AU '5

Q: What are the three phases of creating pre-mRNA? a. Initiation, Elongation and Termination b.…

A: Pre-mRNA, also known as precursor messenger RNA, is the first RNA molecule transcribed from a DNA…

Q: Which sequences are spliced out of the mRNA strand before leaving the nucleus?  In other words,…

A: Answer: TRANSCRIPTION : It is the process in central dogma where a DNA strand is transcribed in to…

Q: If a sequence of bases on a DNA molecule is GATTACA, what would the complimentary mRNA strand look…

A: DNA replication is the process of the formation of identical copies of DNA.It occurs in nucleus.…

Q: Construct an mRNA from a gene and then translate the mRNA into a protein using the genetic code

A: mRNA is produced as a result of transcription from a gene. It is a messenger RNA which is made up of…

Q: Consider the following DNA sequence:CATGTGTAGTCTAAAa. Write the sequence of the DNA strand that…

A: Introduction: DNA is a hereditary material that transfers from one generation to another. It is a…

Q: how does a dna molecule code for a protein

A: Deoxyribonucleic acid or DNA is a molecule that comprises of two polynucleotide chains that wound…

Q: what is Discoveries of the Genetic Code

A: Genetic code was First Discovered by Marshall Nirenberg & Heinrich J. Matthaei.

Q: In transcription, the nucleotide sequence CAATGGC in DNA would code for [1] in mRNA. O GTTACCG O…

A: The genes are the segments of DNA which carries information for the synthesis of the functional…

Q: Use the codon table shown above to help answer this question. What protein sequence would a cell…

A: The mRNA sequence is: 5' CCAUGCACCAAUAGAUAACCG 3' The Codon is read in triplet form.

Q: How many bases would a mRNA have? if it was coded for a protein of 250 amino acids long? explain…

A: The flow of genetic information in a biological system is explained by central dogma and it involves…

Q: Choose the option that goes with the blank. The parentheses after the blank are the choices.…

A: In the process of synthesis of proteins from DNA, the information in DNA is used for the synthesis…

Q: A piece of DNA reads ATGTTATAACCC. If this sequence is transcribed what will be the resulting mRNA…

A: DNA is made up of a long chain of nucleotides, which are composed of a sugar molecule, a phosphate…

Q: Compare the functions of mRNA, rRNA, and tRNA inprotein synthesis.

A: Protein synthesis or translation is the process in which the mRNA molecules were translated into a…

Q: D In the following DNA strand, find the position of the start codon, stop codon and determine the…

A: The given DNA strand - GGTACTTTATACCCTGATACATTTGTGGGG Corresponding mRNA strand -…

Q: summarizes the Genetic code’s main features?

A: A series of codons in messenger ribonucleic acid (mRNA) is termed as genetic code. It translates the…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.