What is the Amino Acid Sequence of 3'-AUG GUA CUC UUA ACA CCA GUG GAA AAA-5'
Q: how is phosphate utilized in humans?
A: Phosphate is derived from phosphoric acid. it is an anion, ester, or salt. A...
Q: Calculate the standard reduction of 3-phosphoglycerate using val ues from your book, and compare the...
A: The standard reduction potential is the potential (in volts) that is generated by a reduction half-r...
Q: Compute for the dilution factor of the WBC pipet if blood is sucked up to 0.2 mark and the diluting ...
A: WBC pipette has markings upto 1 where blood can be sucked and 11 is total capacity of pipette for di...
Q: Protein Isoelectric pH Molecular weight (kDa) Ovalbumin 4.6 45 Insulin 5.4 5.7 Fibrinogen Y-globulin...
A: The separation of proteins by electrophoresis involves the movement of protein molecules in the appl...
Q: What are the two appropriate control groups if flask 2: ‘Yeast + Glucose + Water’ is your experiment...
A: Flask, Tube, water, 1 tbsp sugar, and 1/8 tsp yeast were used in the control group.
Q: What is the definition of hydrolosis reaction?
A: In human body, digestion and glucose metabolism are examples of hydrolysis reaction. Solubilization...
Q: 1. What are the main biological functions of polysaccharides?
A: A carbohydrate is a polysaccharide. It's a polymer made up of monosaccharide chains linked together ...
Q: 1.) What are the main structural features of the mucupolysaccharides chitin? 2.) How do this aid in ...
A: Chitin is a carbohydrates polymer that is composed of N-acetyl glucosamine units attached together v...
Q: How may genes play a role in the susceptibility of inheriting cancers? The reproductive system discu...
A: Cancer is a disease in which the body's cells grow out of control and spread to other tissues. Any o...
Q: Consider the biochemical pathway below, where A, B, and C are substrates and products and E1 and E2 ...
A: Enzymes are proteinaceous in nature. Almost all enzymes are proteins, there are some nucleic acids t...
Q: Which of the following does not involve a dimerization event? Explain why you chose, or did not ch...
A: Protein dimerization event is a event in which two protein monomer molecules forms a complex (that c...
Q: What are the main structural features of the mucupolysaccharides chitin? How do this aid in its func...
A: Chitin: Chitin is a nitrogenous polysaccharide found in the exoskeleton of a tarantula. It is the p...
Q: 1. in cherry crandall method for lipase analysis what is the substrate used?
A: As you have asked multiple questions, we would solve first question for you. If you specific questio...
Q: Would any of the above give a positive Lieberman-Burchard test? Explain your answer.
A: The endocrine system is a vital biological system that produces various hormones. These hormones ser...
Q: Predict how many molecules of NADH and FADH, will result from each of the following molecules when t...
A:
Q: 6 A blocked cat is presented to your clinic. His lab work indicates his serum potassium is 7.6 mmol/...
A: Calculation to make dextrose:
Q: Which of the following affects the rate of enzyme driven reaction? rate constant air pressure conce...
A: Enzymes: Enzymes are biocatalysts that fasten the rate of a chemical reaction. It is proteinaceous ...
Q: Determine whether the following statements describe a reversible competitive inhibitor, a reversible...
A: Inhibitors are the chemical substances that bind to the enzyme and result in a decrease in the catal...
Q: Part I. Answer the following questions in 5 to 7 sentences. 1. What are the main biological function...
A: Starch cellulose and glycogen are different polysaccharides formed of different monomer(monosacchari...
Q: Explain why the maximum initial reaction rate cannot be reached at low substrate concentrations
A: Multiple questions asked. I will answer the first question, as allowed by guidelines. Please repost ...
Q: Describe the methods used to identify the location of DNA binding proteins in the regulatory regions...
A: DNA binding sites are a form of binding website online determined in DNA wherein other molecules may...
Q: 2. The standard state in biochemistry is slightly different than in Physical Chemistry. In biochemis...
A: "Since you have posted a question with multiple sub-parts, we will solve first three subparts for yo...
Q: Please give the color of each analysis indicating positive result and substance formed causing the c...
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and s...
Q: TRUE OR FALSE Coconut oil will give (positive) result to Molisch test.
A: Molisch test is used to detect presence of carbohydrate in a mixture or sample. This test is based o...
Q: 1E In terms of binding adenylate kinase, the Kd for ATP is ~50 M and the KI for GMP-PCP is ~50 nM....
A: Kd stands for dissociation constant while Ki refers to inhibition constant. Both the values play imp...
Q: Create a flowchart of Amino Acids and classify them depending on the polarity of its R group
A: All Amino acids consist of - COOH ( carboxyl group ) and -NH2 group ( amino group), because of the p...
Q: 1.) What are the main structural features of the polysaccharides starch? 2.) How do this aids in its...
A: Polysaccharides are major classes of biomolecules. Polysaccharides are long chain of carbohydrate mo...
Q: 3. Which of the following represents a similarity between RNA and DNA? A. The presence of Uracil (U)...
A: DNA and RNA are both very essential biopolymers that sustain life. It is present in all forms of lif...
Q: What is the difference between obligate and non-obligate chain terminating nucleotides? How were sof...
A: Chain terminating nucleotides are nucleotides which terminates the RNA synthesis, that is also call...
Q: based on the table given, 1. what form of ILY is most present at pH4.0? a. ILY2- b. ILY1- c. I...
A: Provided table shows the acid dissociation constant value for Carboxy, amino terminal and side chain...
Q: Referencing the image above, you are designing an experiment to determine which food source your yea...
A: In retrospect, the fact that the rate of fermentation is dependent on yeast concentration is not sur...
Q: PEI is a ...... charged polyamine and will complex with and precipitate ........ / ..........char...
A: Polyethyleneimine (PEI) is a synthetic water soluble organic polyamine polymer. These polymers can ...
Q: VII. Draw the structure of melezitose (either in Haworth or in conformer): a-D-glucopyranosyl- (1–3)...
A: Melezitose is a trisaccharide composed of three monomeric units. Since there is more than one sugar ...
Q: What is the difference between lysine and arginine? which sidecchain is easier to move across the me...
A: Lysine and arginine are amino acids which forms proteins. Amino acids are organic compounds which co...
Q: All of the following are lipid except. A. Waxes B. Oils C. Butter D. Ether
A: Lipids are organic molecules which are insoluble in water. Lipids include waxes, fats, oils and cert...
Q: A Meselson-Stahl-experiment was performed to study the DNA replication of a newly discovered bacteri...
A: J.Cairns used the autoradiography to establish semiconservativs nature of DNA replication and the mo...
Q: In the first step of the citric acid cycle, an acetyl group from acetyl CoA reacts with oxaloacetate...
A: Citric acid cycle is one of the steps in aerobic oxidation of glucose. It occurs in mitochondrial ma...
Q: opic: Food Science (Carbohydrates: Polysaccharides) Discuss briefly the interactions of starch with...
A: Starch interacts with different solutes like the sugar molecules, acid molecules, mineral, lipid and...
Q: Briefly describe the relationship between degree of unsaturation and the physical characteristics of...
A: Lipids are biomolecules are made up of fatty acids and a glycerol molecule, which are joined to each...
Q: The following data describe binding of ligand A to a protein, using both Scatchard plots and Hills p...
A: Scatchard plots is used to determine the affinity of the receptor or any protein for its ligand and ...
Q: Remembering: Chrysolaminarin is a storage polysaccharide of red algae a storage polysaccharide of di...
A: Carbohydrates are biomolecules that are important for energy generation in living organisms. They ar...
Q: Below are structures of several steroid hormones derived from cholesterol. Circle the steroid nucleu...
A: Steroids are biological compounds which have four rings with specific molecular configuration. Stero...
Q: What Determine the amount of mRNA that is available for translation ?
A: A single-stranded RNA molecule called messenger RNA (mRNA) is complementary to one of a gene's DNA s...
Q: Will a decrease in elevation shift the binding curve of hemoglobin? Will it shift the curve to the ...
A: Binding curve of haemoglobin: this is also called as oxygen dissociation curve which is plotted bet...
Q: What is the effect of the NDM gene?
A: NDM (New Delhi Metallo-β-lactamase) gene, found in Enterobacteriaceae, is a genetic element encodin...
Q: Will a decrease in carbon dioxide (CO2) shift the binding curve of hemoglobin? Will it shift to the ...
A: Hemoglobin (Hb) is a protein present in the red blood cells which is a carrier of oxygen to the body...
Q: 10 Determine the Hill coefficient for the following binding data using a linear method. [L] in micro...
A: The Hill plot is a graph graph which enables us to check whether the protein in question exhibits co...
Q: Bacterial cell walls are made of peptidoglycan to form a rigid structure, the polysaccharide chains ...
A: Peptidoglycan : A polysaccharide consists of 2 glucose derivatives - N-acetylglucosamine(NAG), and N...
Q: Deficiency in which mineral nutrient is responsible for Menkes disease? Phosphorous Molybdenum...
A: Nutrients are important for the growth of organism and to survive and reproduce. Nutrients are requi...
Q: 1. The bond formed between water molecule and the side chain (R group) of serine is A. peptide bond ...
A: A peptide linkage is the backbone of a polypeptide chain. Hydrophobic interaction is formed between ...
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Second letter A UUU UCU) UC UCA UCG UAU UUC Phe UUA Tyr UGU UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu CAUHIS CUU CUC CUA CUG CCU* C ССА CCG CGU His САС Leu CGC Arg CGA Pro CAA Gin CGGJ Gln Which amino acid is carried by the TRNA with the anticodon 5'-UCA-3? ACU ACC ACA AAU AAC. AGU AGC AGA AUU Ser Asn AUC Ile A AUA Thr AAA Lys AAG Lys AGG Arg AUG Met ACG GAU GGU] GUU GUC GUA GUGJ GCU GCC GCA GCG GAC Asp Ala GAA GGC Gly GGA Val GAG Glu GGGJ Isoleucine. None-this is a stop codon. Aspartic acid. Histidine. IV. Leucine O V. Third letter UCAG UCAG UCAG First letterUsing the following sequence and the amino acid chart, please give the amino acid sequence: 5'-UCAGAUGGGAAGCUUGAUCUUGUGA-3'. Abreviations for the amino acids are accepted. Second Position U A G UGU Cys UUU Phe UUC UCU UCC UCA UCG UAU ]Tyr UAC UGC UGA Stop UGG Trp Ser UUA Levu UUG UAA Stop UAG Stop CUU CỤC CUA CUG CU CC ССА CCG CAU His CAC CGU CGC CGA CGG Leu Pro Arg CAA CAG Gln AUU AUC le AUA AUG Met ACU AAU AAC AAA AAG AGU Ser AGC AGA Arg JAsn ACC The АCА Jlys ACG AGG GCU GGU GGC Gly GUU GAU JAsp GAC GUC Val GUA GCC Ala GCA GAA GGA GGG- GCG- GAG JGlu GUG Third Position (3' end) First Position (5' end)Draw the structure of this peptide: N-Met-His-Tyr-Leu-Asp-Ser-Arg-Leu-C
- Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stopFirst letter U C A UUU UU JUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG ] Phenylalanine UCU (Phe) UCC UCA UCG Leucine (Leu) Leucine (Leu) Isoleucine (Ile) Methionine (Met) Valine (Val) CCU CCC CCA CCG b) lysine c) methionine d) tryptophan ACU ACC ACA ACG GCU GCC GCA GCG C Second letter Serine (Ser) Proline (Pro) Threonine (Thr) Alanine (Ala) UAU UAC UAA UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG ] Tyrosine (Tyr) Stop Stop Histidine (His) Glutamine (Gln) Asparagine (Asn) Lysine (Lys) Aspartic acid (Asp) Glutamic acid (Glu) UGU UGC UGA Stop UGG Tryptophan (Trp) CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG ] 1. List the mRNA base codons for the amino acids listed below. 2. a) aspartate: Cysteine (Cys) Serine (Ser) U C Arginine (Arg) A G Arginine (Arg) U C Glycine (Gly) A G U C A G U MCAG АConsider the following two peptides: I. N-Pro-Pro - Glu - Glu - Tyr - His - Cys - Ala - Glu - Gln - Lys - Leu - Ser - Ser - Phe-Leu- Thr - C II. N-Pro-Pro - Lys - Arg - Gly - Tyr - His - Gly - Glu - Asp - Glu - Asp - Glu - Ser - Gly-Phe- Tyr-C Give three reasons why_peptide I is more likely to form an alpha helix in aqueous solution at pH 7.0. Your reasons may include why_peptide Il is less likely to form an alpha helix
- After a polypeptide chain has been synthesized, certain amino acids in the peptide may become modified. For each modified amino acid, identify the standard amino acid from which it is derived. Enter the unabbreviated name of the standard amino acid. OH I *NH,CH,–C–CH,CH,—CH–COO H C *NH₂ standard amino acid: Identify the modification that yields the first amino acid depicted. addition of a hydroxyl group addition of an amino group modification of the existing amino group modification of the existing hydroxyl group elongation of the side chain by the addition of a -CH₂- groupProvide the correct three-letter abbreviation for the following amino acid: Gln ← H₂N-CH-C-C 1 CH3 Ala Arg Asn Asp Cys Glu Gly His lle Leu Lys 包Given the structures of the ribonucleotides and deoxyribonucleotides: Adenine Uracil Thymine HN Adenine NH HO-P-0- CH2 HO-P-0 CH2 HO-P-0-CH2 HO-P-0-CH он он он он OH H OH H Cytosine Cytosine Guanine Guanine NH2 NH NH2 CH2 HOo CH2 HO-P-0 -CH2 он он он он OH H OH H • Draw the structure of the polyribonucleotide UAGCCUG. Draw the structure of the polydeoxyribonucleotide CGTAGAT.
- Identify and encircle the peptide bonds in this polypeptide (Asp-Sec-Leu-Cys-Glu).In the following scheme: HH, H₂C-C-C-Coo II HO H • NH, 1 H₂C-C-C-C000 H 2-Amino-3-ketobutyrate ↓ O H,C-C-CH₂-NH₂ Aminoacetone 0 0 H₂C-C-C-H Methylglyoxal H H₂C-C-COO OH D-Lactate O H₂C-C-C000 Pyruvate What molecule is being metabolized? Identify the reaction at each step. If it is an oxidation-reduction prove this is correct by showing oxidation state changes on the atoms in the structure.What would be the molecular sequence of the amino acid chain asp-leu-leu? (i.e. draw the whole sequence out as molecules joined together)