What amino acids will be positive at a pH of 2? Use the pKa table
Q: What is biosynthesis?
A: Many biological activities, such as metabolism, growth, and development, rely on biosynthesis.…
Q: Some samples may have little to no growth even though microorganisms are present. List four factors…
A: Microorganisms, including bacteria, fungi, viruses, and other microscopic…
Q: Gluconeogenesis requires how many NTPs (nucleotide triphosphates, i.e. ATP, GTP)? Group of answer…
A: Gluconeogenesis is a metabolic process that involves the synthesis of glucose from molecules that…
Q: Describe in your own words why it makes sense for the RNA polymerase and the ribosome to form a…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: 18. Which of the following is true? A. When acid is added to pure water, kw, the ion-product…
A: Pure water i.e. H2O is a weak electrolyte. It does not dissociates completely into its ions i.e. H+…
Q: 2. What is the relationship between the energy charge of a cell and control of the ATP-generating…
A: The energy charge of a cell is the ratio of high-energy phosphates (ATP and GTP) to low-energy…
Q: Based on the list of intra- and extracellular concentrations shown below, ( ) is probably used as a…
A: Change in Gibbs free energy (∆G) of ion transport is given by the equation shown below. ∆G = ZF∆ψ +…
Q: Explain the reaction that is shown with the scheme below by your words.
A: Enzymes are proteins that are responsible for catalyzing biological reactions. They have an integral…
Q: DNA: 3. 2. 1: what is #1? 3: (name the sugar) 2: N bases used RNA: 3. 1: what is #1? 2. 3: (name the…
A: In the given question we have two figures One of the DNA and the other of RNA. DNA consists of a…
Q: 33. Gel filtration chromatography shows that the molecular weight of a protein is 240,000 Daltons.…
A: The different levels of protein structure are primary, secondary, tertiary and quaternary. The…
Q: 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 70…
A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…
Q: Phosphorolysis is an important part of how our muscle and liver cells break down glycogen. What is…
A: Cellular metabolism refers to the entirety of biochemical reactions that occur within a cell. It…
Q: From your Lineweaver-Burk plot, derive the values for the following table. Indicate the appropriate…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: The response the AI gave me contains several errors. These errors include incorrect facts and…
A: Polyglutamic acid is a polymer of glutamic acid units. There are two types of polyglutamic acid:…
Q: 13.74 Why are lactose and maltose reducing sugars, but sucrose is not? (13.6)
A: Carbohydrates are organic compounds composed of carbon, hydrogen, and oxygen atoms. Carbohydrates…
Q: How many ATP are produced by substrate level phosphorylation ONLY in the complete oxidation of…
A: Beta-oxidation is a cyclic process. Beta oxidation breaks down activated palmitate to its acetyl-CoA…
Q: Can the fatty acid B be used to generate glucose in animals and is this possible for an unbranched…
A: Beta oxidation: The enzyme fatty acyl-CoA synthase (FACS) adds a CoA group to the fatty acid chain…
Q: By mistake, you add two primers to your DNA sequencing reaction. The primers anneal on the same…
A: The correct answer is:B. The detector will detect two nucleotides at about 75% of the positions.
Q: Based on the image below, select the correct statements. Note: There may be more th 1 correct…
A: Purines are a heterocyclic organic compound that has 5-member rings fused to a 6-member ring.…
Q: Nicotiana tabacum cells are cultured to produce a polysaccharide gum. The reactor used is a…
A: The system or any device which provides a controlled environment for the growth of the…
Q: Which of the following protocols is BEST used for introducing exogenous DNA into a cell with a thick…
A: The gene gun approach is the most effective method for transferring exogenous DNA into a cell with a…
Q: Chemical energy contained in the fatty acids that are produced in the digestion of triglycerides is…
A: B-oxidation converts fatty acids from triglyceride breakdown into chemical potential energy in NADH…
Q: Blood sugar homeostasis: Indicate the order of events that will happen following blood glucose…
A: After a meal, blood glucose increases. To maintain blood glucose level, insulin is released by the…
Q: From the graphs given, can you find the Km from the Michaelis-Menten curve and the Lineweaver-Burke…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Treatment with NAD for hangovers: possible? Explain?
A: NAD, or nicotinamide adenine dinucleotide, is a coenzyme found in all living cells. It is involved…
Q: 17. Melittin is a 26-amino acid polypeptide found in bee venom. In its monomeric form, melittin is…
A: As per the fluid mosaic model, biological membranes are made up lipid bilayer with proteins…
Q: The active site of an enzyme binds specifically to a substrate. Your text mentions an early idea…
A: Enzymes are high molecular weight proteins molecules that catalyse biochemical reactions. The…
Q: N-(2-hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) buffer at pH 7 with 400 mM NaCl. A A…
A: The principle of equilibrium states that when the two compartments are separated by a semi-permeable…
Q: 2) Table 1 shows some of the events which take place in protein synthesis. (LO 1.2) ² second A tRNA…
A: Note: Please upload your other questions separately as according to the answering policy the tutors…
Q: Identify each of the following as a catabolic or an anabolic process using the dropdown on the…
A: Catabolic Process: The metabolic pathway in which larger molecules are broken down into smaller ones…
Q: I was wondering if it is possible to provide an explanation on the structure of the PDB code 2V1X,…
A: Each PDB code represents a unique identifier for a particular protein structure. The PDB code is…
Q: The fatty acid side chains of the phospholipids in the inner mitochondrial membrane exhibit a large…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: n DNA doubvle digestion, why is thermal inactivation required
A: Thermal inactivation is an important step in DNA double digestion research. DNA double digestion…
Q: "Five prime to three prime" description of a DNA strand refers to: A. the phosphodiester backbone…
A: "Five prime to three prime" description of a DNA strand refers to: B. the phosphorylated 5' carbon…
Q: For the two conditions below regarding Glycogenolysis, please explain how glucose release would be…
A: It is the phenomenon where glycogen in the hepatocytes or myocytes, breaks to release two end…
Q: Draw two reaction coordinate diagrams (DG vs reaction coordinate) that compare the uncatalyzed…
A: As per the fluid mosaic model, biological membrane surrounding the cells is a lipid bilayer with…
Q: 6. Give the name of the disease that is causing the baby's symptoms. Explain why the symptoms are…
A: Glucose dehydrogenase is an enzyme that is involved in the pentose phosphate pathway that catalyzes…
Q: volume of the quasi-steady-state culture was V0= 500 L, and the nutrient solution containing glucose…
A: For achieving the optimal growth of the microorganisms or cells in culture the quasi-steady state or…
Q: Explain why breathing in a brown bag paper helps with hyperventilation. Explain using Le Chatelier's…
A: Le Chatelier's Principle explains why breathing into a brown paper bag can help manage…
Q: 7.1 The following results were obtained for an enzyme-catalysed reaction Substrate concentration…
A: Enzyme-catalyzed reactions are reactions that take place with the help of enzymes which depend on…
Q: Which step of glycolysis does citrate regulate (does it activate or inhibit that step?) 2. WHY…
A: Citrate is the product of the first step of TCA (Tricarboxylic acid ) cycle. High citrate…
Q: Show how to bring about the following chemical transformation. This transformation might require one…
A:
Q: 2. WHY IS NOMENCLATURE IMPORTANT? HOW DO YOU SEE IT BEING HELPFUL IN THE FUTURE?
A: Scientific disciplines require nomenclature, the systematic naming of compounds, elements, and…
Q: The image below shows the ATP cycle. From the statements below, select the correct statement about…
A: ATP stands for adenosine triphosphate. It is very crucial molecule that serves as the primary energy…
Q: The Hill coefficients for NAD+ binding to the T. tenax GAPDH in the presence and absence of NADP+…
A: Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) can be either phosphorylating or…
Q: question
A: 79ac4c41-0543-4987-bd8c-f7f9d1d1b7c1
Q: Can you please re-draw this diagram again more clearly in a digital format
A: Alzheimer's disease is a neuronal disease caused due to abnormal build-up of proteins in and around…
Q: Decylic acid is a saturated fatty acid that occurs naturally in coconut oil and palm kernel oil.…
A: We are given a saturated fatty acid containing 10 carbon atoms. Its catabolism starts with its…
Q: 2. WHY DO ACTIVATED STATES RARELY OCCUR AT PHYSIOLOGICAL TEMPERATURES? HOW DO CELLS OVERCOME THIS?
A: Biochemistry requires understanding why activated states rarely occur at physiological temperatures…
Q: 2. true/false: decreased oxaloacetate would cause increased flux though the citric acid cycle I…
A: Oxidation of glucose via the glycolytic pathway in the cytoplasm produces pyruvate which is oxidised…
What amino acids will be positive at a pH of 2? Use the pKa table
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Of the 20 protein-derived amino acids shown in Table 27.1, which contain Q.) no chiral centerTABLE 5.1 Properties of the common amino acids found in proteins pKa of lonizing Residue Mass Occurrence pKa of a-COOH Group a-NH3 Group pKa of Abbreviations 1- and 3-letter codes Name " Side Chaina (daltons) in Proteins (mol %) Alanine A, Ala 2.3 9.7 71.08 8.7 Arginine R, Arg 2.2 9.0 12.5 156.20 5.0. Asparagine N, Asn 2.0 8.8 114.11 4.2 Aspartic acid D, Asp 2.1 9.8 3.9 115.09 5.9 Cysteine C, Cys 1.8 10.8 8.3 103.14 1.3 Glutamine Q, Gln 2.2 9.1 128.14 3.7 Glutamic acid E, Glu 2.2 9.7 4.2 129.12 6.6 Glycine G, Gly 2.3 9.6 57.06 7.9 | Histidine Н, His 1.8 9.2 6.0 137.15 2.4 Isoleucine I, lle 2.4 9.7 113.17 5.5 Leucine L, Leu 2.4 9.6 113.17 8.9 | Lysine K, Lys 2.2 9.0 10.0 128.18 5.5 Methionine М, Met 2.3 9.2 131.21 2.0 Phenylalanine F, Phe 1.8 9.1 147.18 4.0 Proline P, Pro 2.0 10.6 97.12 4.7 Serine S, Ser 2.2 9.2 87.08 5.8 T, Thr W, Trp Y, Tyr Threonine 2.6 10.4 101.11 5.6 Tryptophan 2.4 9.4 186.21 1.5 Tyrosine 2.2 9.1 10.1 163.18 3.5 Valine V, Val 2.3 9.6 99.14 7.2 | Approximate valuoc…Porcine dynorphin is a neuropeptide having 17 amino acid residues. Its structure is shown below. Tyr-Gly-Gly-Phe-Leu-Arg-Arg-Ile-Arg-Pro-Lys-Leu-Lys-Trp-Asp-Asn-Gln 8. How does trypsin catalyze the hydrolysis of peptides? You can answer this question by identifying the amino acids involved and whether the hydrolysis is at their amino side or the carboxyl side or if particular amino acids end up at the N-teminal end or at the C-terminal end. 9. List down the different fragments that would result if dynorphin were cleaved by trypsin. 10. How does chymotrypsin catalyze the hydrolysis of peptides? You can answer this question by identifying the amino acids involved and whether the hydrolysis is at their amino side or the carboxyl side or if particular amino acids end up at the N-teminal end or at the C- terminal end. 11. List down the different fragments that would result if dynorphin were cleaved by chymotrypsin. 12. Cyanogen bromide is a chemical reagent which also cleaves peptide bonds.…
- Amino acids project from each polypeptide backbone in a β-sheet in an alternating fashion (oneabove the plane and the next below the plane – see Fig 3.8B). Consider the following proteinsequence: Leu-Lys-Val-Asp-Ile-Ser-Leu-Arg-Leu-Lys-Ile-Arg-Phe-Glu.a. Is there a pattern to these amino acids? If so, what is it? b. What does this sequence of amino acids mean for the hydrophobicity/hydrophilicity of theresulting β-sheet? c. Can you make a prediction about how the β-sheet will be arranged in higher levels of protein structure? If so, what prediction would you make?0ミレーNレ NH geometry on both cand N. Torigonal plannes CH - C-N o=), HN CH2 CH-C-OH (a- carbon) CH2 HooC Aspaxagine - Toline - Valine - Arginine - phenylalcmine - Glutamic ocid. 1.Give the name and three letter code for each amino acid in the peptide. e 2. At pH 7, approximately what charge would be on your peptide? Explain your answer. 3. Can your peptide form intra/interchain disulfide bonds? Explain why/why not. e 4. Will your peptide absorb UV and is it fluorescent? Explain why/why not. e 5. What is the probability that your peptide contains a cis peptide bond? Explain your answer.Based on the pK, table for amino acids (Table 1.1), draw the structures with net charge, and the equilibria representing the complete deprotonation of aspartate. Table 1.1 Name pK pk2 pKR Glycine Alanine 2.4 9.8 2.3 9.7 Valine 2.3 2.4 9.6 Leucine 9.6 Isoleucine 2.4 9.7 Methionine 2.3 9.2 Phenylalanine Proline Serine 1.8 9.1 2.0 10.6 2.1 9.2 Threonine 2.6 10.4 Cysteine Asparagine Glutamine 1.8 10.8 8.3 2.0 8.8 2.2 9.1 Tyrosine Tryptophan Aspartate Glutamate 2.2 9.1 10.9 2.4 9.4 2.0 2.2 10.0 3.9 9.7 4.3 Histidine 1.8 9.2 6.0 10.8 Lysine Arginine 2.2 9.2 1.8 9.0 12.5
- What amino acid/s is/are isolated when Ala-Lys-Val-Phe—His-Tyr-Gly is treated with trypsin and products are treated further with chemotrypsin? Construct the primary structure of the remaining undigested proteinsWrite the chemical structure of peptide containing the following amino acid PRO-SER-GLY-LEU I NEED IT ASAP PLEASECalculate the net charge of the following peptide at pH 2, pH 6 and pH 14 (use 2 and 9 as pKa values for the carboxylic acid and amino groups, respectively, use the attached table for the side chain pKa values). Ile-Leu-Ile-Lys-Glu-Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr
- The melanocyte-stimulating peptide hormone a-melanotropin has the following sequence:Ser–Tyr–Ser–Met–Glu–His–Phe–Arg–Trp–Gly–Lys–Pro–Val(a) Write the sequence using the one-letter abbreviations.(b) Calculate the molecular weight of a-melanotropin, using data inTableThe tripeptide +H3N-Leu-His-Glu-COO- has pKa values of 2.2, 3.6, 6.0 and 9.1. The isoelectric point (pI) for this peptide will be: 8 5 6 4 None of the aboveAfter the polypeptide shown below was treated with maleic anhydride, it was hydrolyzed by trypsin. (After a polypeptide is treated with maleic anhydride, trypsin will cleave the polypeptide only on the C-side of arginine.) Gly-Ala-Asp-Ala-Leu-Pro-Gly-Ile-Leu-Val-Arg-Asp-Val-Gly-Lys-Val-Glu-Val-Phe-Glu-Ala-Gly-Arg-Ala-Glu-Phe-Lys-Glu-Pro-Arg-Leu-Val-Met-Lys-Val-Glu-Gly-Arg-Pro-Val-Gly-Ala-Gly-Leu-Trp In what order will the fragments be eluted from an anion-exchange column using a buffer of pH = 5?