VHL ceases to induce the degradation of HIF-1α under which of the following conditions?      A. Hypoxia       B. Ionizing radiation    C. Hyperoxia     D. UV radiation

Q: Venurafenib Select one: a. Was developed as a treatment of Gleevec-resistant CML patients b.…

A: Vemurafenib is an inhibitor of B-RAF enzyme and the name is derived from V600E mutated BRAF…

Q: In covid-19 myocarditis happened, and endothelial cell is in charge of inhibiting the inflammation,…

A: Coronaviruses are a huge own circle of relatives of a positive-stranded, enveloped RNA viruses that…

Q: Based on the principles of RP-HPLC, which sub fraction in the figure (P1 to P8) is the most polar?…

A: HPLC (High Performance Liquid Chromatography): This method is used for protein purification. Here…

Q: which of these describes the symptoms of the disease(s) caused by mutations in this gene…

A: Mutation in the following gene i.e. XPA gene, causes malfunctioning of DNA repair mechanisms of our…

Q: Developing B cells that fail to make productive D to J heavy-chain rearrangements on both homologous…

A: B cells get matured in the bone marrow or in the lymph node. Mature B cells express antibodies on…

Q: Briefly discuss the reason why CoQ10 has been formulated into skin care products and used as food…

A: CoQ10 Coenzyme Q10 naturally occurs in the human body and it found in almost all cells of the human…

Q: Retroviruses such as HIV, Herpesviruses, and Hepatitis B can be effectively inhibited by _____. Mark…

A: Nucleoside analogs such as acyclovir are antiviral drugs that can effectively inhibit the…

Q: Treatment of cells with a drug that blocks the function Ran-GAP would result a. the accumulation of…

A: Proteins are transported into and out of the nucleus by nuclear pore complexes, which entail a…

Q: 1. Construct one plot including the data for the WT and the MC4R mutants presenting the differences…

A: A G protein-coupled receptor (GPCR) helps control how much energy we have. The hormone called MC4R…

Q: 47. hTERT is repressed in these cells: A. Germ cells B. Tumor cells C. Somatic cells D. A and B

A: hTERT is represses in the cells.

Q: Explain in detail how an ER-positive breast cancer be treated with aromatase inhibitors

A: Breast cancer It is defined as malignant growth that begins from the epithelial lining of the breast…

Q: One of the treatments for sickle cell anemia is hydroxyurea, which is known to induce the expression…

A: The most important mutation is the third one where serine replaces histidine. Whereas histidine is…

Q: Compared to adult Hb (HbA), fetal Hb (HbF) has one less histidine in the central cavity where BPG…

A: Humans have both Hb A and Hb F hemoglobin which are present in adult and fetal life respectively.…

Q: Explain the overexpression of a protein that binds to the Fas ligand contributes to the survival of…

A: A  transmembrane protein called Fas ligand is found on the surface of lymphocyte cells. It binds to…

Q: Which sigma factor is activated in the stationary phase? O A. RpoN O B. RpoE O C. RpoH O D. Rpos O…

A:

Q: What is/are product(s) from commensal bacteria that regulate the expression for ler, regulator of…

A:

Q: Sickle cell anemia is associated with which of the following:   Question 27 options:   Sticky…

A: Sickle cell anemia : It is caused by the single acidic amino acid substitution, Glu 6th position to…

Q: Which type of cancer has been treated with ipilumumab?With what success?

A: The immune system of the body protects the individual from the attack of external pathogens. The…

Q: 100) The HA protein of Influenza vaccine is a. The HA1 is responsible for binding to unexposed…

A: Answer :- Option (B) is correct. - The HA protein of influenza vaccine is the HA protein of the…

Q: Although homozygous deficiencies in complement regulatory proteins cause serious diseases, more…

A: The proteins that interact with complement system components are known as complement regulatory…

Q: 20.23 please

A: Retrovir (zidovudine, additionally referred to as AZT) was first studied as an anti-most cancers…

Q: Select all of the statements that apply to transcytosis. A. Transfers dimeric IgG B. Transfers…

A: Introduction :- Transcytosis is the process by which a ligand is taken up by a receptor on one side…

Q: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute…

A: Acute myeloid leukemia is a disease that interferes in the production of normal blood cells. It is a…

Q: photo-active platinum-based anticancer drugs

A: A group of therapeutic medications known as photo-active platinum-based anticancer therapies rely on…

Q: Given below is the electrophoretic profile of 2 proteins, a normal hemoglobin, HbA and the fetal…

A: Protein electrophoresis is a method that separates proteins based on their size and the electrical…

Q: Which ONE of the following molecular abnormalities is associated with the POOREST prognosis in acute…

A: Acute myeloid leukemia (AML) is a kind of blood cancer.

Q: Identify two ways in which IL-1β is regulated so as to minimize its destructive potential in the…

A: A prime factor involved in host immune response to infection or injury is Interleukin-1β (IL-1β), a…

Q: Which ONE of the following genetic patterns defines a patient with acute myeloid leukaemia with the…

A: Any kind of alteration in the nucleotide sequence of an organism’s genome is referred to as a…

Q: technical description of how the chemotaxis systems work in gene regulation?

A: Chemotaxis is the movement of cells or organisms in response to chemical gradients, either towards a…

Q: Define the following terms: a. phosphatidylinositol cycle b. PIP2 c. IP3 d. DAG e. PKC

A: The membrane is known to be composed of a phospholipid, cholesterol, and protein. The membrane…

Q: Define the following terms: a. intrinsically disordered protein b. intrinsically disordered region…

A: Note: Since you have posted a question with multiple subparts, we will solve the first three…

Q: Wild type 0.09 E104K G238S --+-- 0.13 1.41 A42G G238S ‒‒‒ E104K A42G -++-- 1.41 --+-+ 362 G238S A42G…

A: Antibiotic dosing regimes could be tailored to enhance the efficacy of the drugs by being able to…

Q: Explain why use of a 5 alpha reductase inhibitor is a treatment for benign prostate hyperplasia

A: Prostate is defined a small gland that is present inside the groin located between the bladder and…

Q: Please describe/name the structural variants describe in the picture: Courtesy of CRC Press/Taylor &…

A: Structural variation (SV) is generally defined as a region of DNA approximately 1 kb and larger in…

Q: A) 43 14 When Friend erythroleukemic cells are incubated with sodium butyrate, they differentiate…

A: Introduction :  Histones are highly alkaline proteins. They are found in the nucleus of the…

Q: Lactic acidosis is a potential adverse side effect most commonly seen with which of these agents?…

A: Lactic acidosis is a medical condition characterized by the buildup of an excessive amount of lactic…

Q: Hereditary retinoblastoma generally affects children in both eyes, while spontaneous retinoblastoma…

A: Retinoblastoma is defined as a type of cancer that starts in the retina and is located in the back…

Q: Researchers have suggested that sleep apnoea (the tendency to occasionally stop breathing when…

A: In a research study, scientists looked at how sleep apnea might affect asthma caused by allergens.…

Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…

A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…

Q: 1. "Interferons (IFNs)‐α and ‐β are expressed in response to a virus infection and are released from…

A: Interferons inactivates protein synthesis in cells to block the viral replication.

Q: Which of the following drugs would you expect would prevent transformation of cells by the Rous…

A: Option D- Reverse Transcriptase Inhibitor-  is the answer

Q: Nutriceutical. c) Give examples of medications prescribed in alternative medicine. Is it necessary…

A: Alternative medicine is a term that encompass a variety of medical practices among different…

Q: Define the following terms: a. asparagine-linked oligosaccharide b. mucin-type oligosaccharide c.…

A: Introduction : Any foreign substance that is responsible for generating an immune response in the…

Q: Which of the following statements are correct about the drug Gleevec (select all that apply)?   A.…

A: Imatinib Mesylate is sold under the brand name Gleevec. It is a chemotherapeutic medicine taken…