Promoter 5' UTR Coding region Transcription start site 5'-TACCCAGATAATATATACGCATGACACATATGGACACCGATTATAAAGATATCTACTGCCGCGAGAATTATAG-3' 3' UTR Translation start codon Translation stop codon For each DNA sequence below, there is a single nucleotide mutation in the DNA sequence. For all examples, the mutation is highlighted in orange. A codon table is provided on the second page for your reference. Answer each of the following questions for EACH DNA sequence: A) what type of mutation is shown based on the nature of the genetic change (frameshift mutation or point mutation; if a point mutation, transition or transversion) B) what type of mutation is shown based on the functional impact on the organism (frameshift, silent, missense, nonsense, noncoding) C) What do you predict the effect of that mutation will be on either the structure or function of a protein, or on the phenotype of the organism. Explain your answer. For this part, there are some examples where you should know exactly the effect of the mutation, and some where you may have to infer this information based on the location of the mutation.

What would be the percentage of G, C, A, and T in each column? Have to calculate the nucleotide frequency from my sequence.

A elearn.squ.edu.om/mod/quiz/attempt.php?attempt-D1335328&cmid%3D6971498&page%=D1 System (Academic) Answer: If a sequence of DNA has 20% Guanine bases how many Adenines would it have? Select one: О а. 10% ОБ.20% O c. 30% O d. 40% O e. 50% A scientist noticed that his sample of cvanobacteria moves towards the side of the petn di

Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop sequences.  UGCGAUGGCAAUCGGUGUACCCCUGACUGAGC

Identify (and highlight or underline) the one nucleotide difference between the original (left) and altered (right) sequences

Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucine

Can you help me solve this sequence question and identifty the mutation?

If a codon GCA codes for the amino acid alanine in a prokaryote, what will it code for in a eukaryote? _____

Please answer all parts of this question

What is the term applied to the trinucleotide shown by the arrow? 5' Py U AU AGGCC G C G ACCACCUGe