Q: Figure 1. Bean (dicot) and corn (monocot) seedling diagram under 10X magnification "Romane" Bean…
A: Theory behind the non-cellular layers that reduce desiccation in corn and beans: In plants,…
Q: The lining of the GI tract is called the mucosa. True False
A: The gastrointestinal (GI) tract is a long, hollow tube that extends from the mouth to the anus. It…
Q: Give only typing answer with explanation and conclusion A mothers father who is not bald marries a…
A: The likelihood of inheriting certain traits, such as baldness, can be a subject of curiosity when…
Q: Plasmid A carries an ampicillin resistant gene (bla) and a gene for production of a GFP protein;…
A: Plasmids are important tools for modifying and analyzing genes in genetic engineering and molecular…
Q: Give typing answer with explanation and conclusion Development of the Nervous System 3. The neural…
A: It is the network of cells and nerves, which acts as messengers between the brain and spinal cord…
Q: Describe the basic pathway of information flow through neurons that causes you to turn your head…
A: Nervous system in the human body involves in coordination and control various types of activites.…
Q: only one sentences please define these three words 1. Conservative model of dna replication 2.…
A: Replication: DNA( Deoxyribonucleic acid ) replication is a process of making DNA from a template…
Q: a study to assess the strength of selection on alleles of a gene “B” which affects brightness of the…
A: In the study assessing the strength of selection on alleles of a gene "B" that affects the…
Q: What are the most common species that are used as indicator species for freshwater analysis of…
A: Introduction Diatoms and dinoflagellates are two types of single-celled microorganisms that are…
Q: Which of the following mobile genetic elements is not a retrotransposon? the Alu pseudogene…
A: Retrotransposons are genetic elements that move within a genome via an RNA intermediate and use a…
Q: Briefly describe how we become tolerant to self-antigens pre- and post- birth, and explain how…
A: Sometimes the proteins present inside the body may be confused by the immune cells as non self. As a…
Q: Calculate the molar enthalpy of formation for HCl(g) given: HCl(g) + KOH(s)--> KCl(s) + H₂0 (1) What…
A: Answer.) :-To calculate the molar enthalpy of formation for HCl (hydrochloric acid) using the given…
Q: 1) Evolution describes the change of the genetic makeup of __________ A)a population. B)an…
A: A) a population.Evolution is the process of change in the inherited characteristics of a population…
Q: Harmful bacteria can cause gastritis and peptic ulcers.
A: Gastritis refers to inflammation of the stomach lining, while peptic ulcers are open sores that…
Q: human visual system
A: It is a complex biological system which allows us to perceive and process visual information from…
Q: Serum osmolality increases by about ____ mOsm/kg for each 60 mg/dL increase in serum ethanol. a. 1…
A: Serum osmolality test is used to check the fluid-particle balance in the body. It looks for chemical…
Q: Experiment about the, "Effect of Light Stress on Germination and Growth Parameters of Corchorus…
A: The experiment is called Effect of Light Stress on Germination and Growth Parameters of Corchorus…
Q: Give typing answer with explanation and conclusion What is a codon?
A: The gene (functional part of DNA that undergoes expression) produce RNA by the transcription process…
Q: Describe stepwise the pre-mRNA processing, how small noncoding RNAs regulate gene expression and…
A: A gene is made up of DNA. It is eventually transcribed into mRNA that helps in the process of…
Q: Most medically useful antibiotics interfere with either peptidogly¬can synthesis or ribosome…
A: Antibiotics need to selectively target bacterial structures or processes while sparing human cells…
Q: Describe, with examples the role of the cell membrane and cytoskeleton in mitosis.
A: During the process of mitosis, the cell membrane and cytoskeleton play vital roles in facilitating…
Q: Insulin is a blank a soluble hormone. Therefore it can/cannot cross the plasma membrane
A: Insulin is a hormone produced by the pancreas in response to elevated blood glucose levels. It plays…
Q: 9 Identify A) the beef cut and B) all skeletal (bone) structures by their scientific names.
A: Pigs have a skeletal system made up of bones, cartilage, and ligaments that aid in mobility and…
Q: dentify at least three key actions of epinephrine that render this agent beneficial for treating…
A: Adrenaline, often known as epinephrine, is a chemical that occurs naturally in the body. The adrenal…
Q: The given pedigree chart corresponds with generational cystic fibrosis. If individuals III-2 and…
A: Pedigree analysis helps us to understand the mode of a particular disease that is inheritable by…
Q: https://m.youtube.com/watch?v=3KL7lcWMkz0&pp=ygUbMjEuIHRoZSB0dXNrZWdlZSBleHBlcmltZW50 Where and…
A: Tuskeegee experimental study was a kind of unethical study performed in the past. The study was…
Q: The given pedigree chart corresponds with the PTC taste test. What is the genotype for individual…
A: Genetic disorder is of two types, autosomal and sex-linked. Autosomal genetic disorder is again…
Q: What major theme in biology do substrate-enzyme interactions fit under? Choose the BEST answer.…
A: Substrate-enzyme interactions play a crucial role in many biological processes. Enzymes, which are…
Q: You are employed in a gene therapy laboratory to test the effectiveness of a vector for correcting…
A: The CFTR gene encodes the CFTR protein (cystic fibrosis transmembrane conductance regulator). It is…
Q: What is the role of Agrobacterium tumefaciens in the production of transgenic plants?
A: Agrobacterium tumefaciens is a natural genetic engineer that inserts its own DNA into the plants it…
Q: DNA sequence A: 5' - 3' TAACTTAAGGCCAATCGAAATCTTAAGGCGGTATACGCGTTAACCTTAAGG 3' DNA sequence B: 5'…
A: Restriction enzymes are restriction endonucleases that have specific restriction sites and…
Q: What proteins are crucial for creating and maintaining DNA replication forks? Choose the best…
A: Replication in the process in which double stranded-DNA is duplicated or copied to produce two…
Q: Mrem is a value that indicates the amount of radiation damage incurred. Radiation dose should be…
A: In radiation dosimetry, the effective absorbed dose is an important measure of the biological impact…
Q: DNA indirectly creates protein. O True O False
A: A polymer made of two polynucleotide chains which wrap around one another to create a double helix…
Q: 1. What fermentation tube is the control tube in this experiment? 2. What two fermentation tubes can…
A: Yeast fermentation is a metabolic process that occurs in yeast cells, wherein they convert sugars…
Q: Dilution Problem. A culture was diluted as follows: (1) 50mL are added to 100mL of water. (2) 1mL…
A: It refers to the process of reducing the concentration of a substance in a solution by adding more…
Q: Define these terms (most will Pioneer species Urbanization/urban sprawl Resource portioning…
A: Several terminology are used in the study of ecology and community dynamics to help us understand…
Q: Which stage of disease is the most important to limit the time of? Prodromal O Incubation O Period…
A: The periods or stages of disease progression each carry different implications for the patient and…
Q: Organ Stomach* Small Intestine* Structure Cardiac sphincter Cardiac region Pyloric sphincter Pyloric…
A: Each organ and it's tissues are dedicated to certain task which it needs to perform to carry out…
Q: 11-1 Family 1 1-1 11-2 1-2 11-3 III-1 III-2 Family 2 1-3 11-4 111-3 1-4 11-5 III-4 111-5
A: The carrier of a disease is the person whom have one copy of a mutated or changed disease causing…
Q: The phylum Chordata only contains vertebrate species. Question 4 options: True False Which…
A: According to our guidelines we can answer only 1 question (up to 3 subparts). You upload all…
Q: A graduate student is trying to identify the gene coding for an enzyme found in a bacterial species…
A: Trinitrotoluene (TNT), a solid organic nitrogen chemical that is mostly utilised as an explosive and…
Q: True or False: An opportunistic pathogen always causes disease.
A: An organism that causes disease is referred to as a pathogen. Microbes are ubiquitous in the human…
Q: 5. Below is a segment of RNA, transcribed from a DNA sequence. Use the following codon chart to help…
A: A. The polypeptide generated by the given RNA sequence is "Met-Pro-Thr-Asp-Trp-Pro."b. The mutation…
Q: Diabetes insipidus:* a. Hypernatremia due to decreased water intake b. Hypernatremia due to excess…
A: Diabetes insipidus is a disorder that occurs when there are low levels of ADH (Antidiuretic hormone)…
Q: feature or characteristic is present in more than one specimen, list them all. Add a descriptive and…
A: Sprouting Of seed or spore, after a period of dormancy is called as germination. Germination depends…
Q: Autosomal Dominant Disorder: Huntington's Disease 1. Huntington's disease is a neurological disease…
A: The alleles are alternative forms of a gene that are located on the same locus of a homologous…
Q: Which of the following is/are not necessary for transcription to occur? A. Promoter region B.…
A: D. Stop codonThe stop codon is not necessary for transcription to occur.Transcription is the process…
Q: Fill in the chart AND answer the question at the bottom of the page. Answer it accurately and…
A: A mutation is an event where the DNA sequence gets changed as a result different types of sequences…
Q: Question 1 Damage to the semilunar valves can O a. increase SV Ob. decrease SV Oc. decrease ESV Od.…
A: Semilunar valves are a type of heart valve located between the ventricles and the major arteries…
Step by step
Solved in 3 steps
- True/False: Mucosal surfaces and external epithelia are major routes of pathogenic infection. Mucosal surfaces are found in tissues such as the gastrointestinal tract, the reproductive tract and the mouth and respiratory tract. While the mouth and respiratory tract are routes of virus but not bacterial infections, the gastrointestinal tract is the route for bacterial but not virus infections.Which of the following can help prevent hospital-acquired pneumonia? Keeping the patient well sedated and good oral hygiene. Placing the patient in a prone position and prophylactic antibiotics. Maintaining good hydration and chest physiotherapy. Minimal use of sedation and good oral hygiene.Erythromycin is the most commonly prescribed form of antibiotic in dentistry. True False
- Personal protective equipment (PPE) refers to wearable equipment that is designed to protect you from exposure to or contact with infectious agents. Question options: A) True B) FalseIn your own words, explain the four topics of medical emergencies namely, Fever and Heat Related Injuries, Head and Neck Problems, Allergies, and Animal Bites and Stings; Poisoning, and explain why it is important to learn them. Write in 500 words.Mrs. Kirby is a volunteer at a hospice. She is confused about the disease AIDS and is afraid if she comes in contact with a patient’s urine or feces she may get the disease. Lauren, the licensed practical nurse, tries to reassure Mrs. Kirby she cannot get AIDS in this manner. The following actions may help Lauren explain the disease to Mrs. Kirby. Describe opportunistic infections.
- Match the disease/organism to the description. Rabies [ Choose ] [Choose] Caused by a toxin that inhibits the release of neurotransmitters (GABA and Glycine) at neuromuscular junctions. This disease is caused by Neisseria meningitidis and commonly occurs in college-age students. This is a prion disease caused by an infectious protein. This disease is caused by a virus that is transmitted through the fecal-oral route, and, rarely, causes paralysis. This viral disease is usually contracted through a bite where it presents in three forms: atypical, encephalitic, and paralytic. This disease is caused by a toxin that blocks acetylcholine release at neuromuscular junctions. These diseases are caused by viruses, like Eastern Equine Virus and West Nile Virus. Mosquito-Borne Encephalitis Poliomyelitis Meningococcal Meningitis [ Choose ] Botulism [ Choose ] Tetanus [ Choose ] Spongiform Encephalopathy [ Choose ]True or False Reyne has colds. She sneezed but covered her mouth with her hands. This completes the first three components of chain of infection which are the Pathogen, Reservoir, and Portal of Exit. True or False Reyne then shakes hands with Angel who recovered from the same colds virus. The handshake can now make Angel sick again since the succeeding components of the chain of infection have complete True or False (CASE 1) The class of Ms. ABC was performing a laboratory activity where they are to collect acetylene gas from dissolving calcium carbide in water. Before the activity started, she instructed her students to avoid using matches or lighter because the gas is flammable. When she went out of the laboratory to answer an urgent call, she heard a sudden explosion from the room. Based from the following actions, which should be the first thing Ms. ABC should do? a.Report the incident at the technician’s officeb.Open all laboratory doors so the student can go out of the room…Case: You are a general practitioner, and a mother comes into your office with her child who is complaining of flu-like symptoms. Upon entering the room, you ask the boy to remove his shirt and you notice a pattern of very distinct bruises on the boy's torso. You ask the mother where the bruises came from, and she tells you that they are from a procedure she performed on him known as "cao gio," which is also known as "coining." The procedure involves rubbing warm oils or gels on a person's skin with a coin or other flat metal object. The mother explains that cao gio is used to raise out bad blood, and improve circulation and healing. When you touch the boy's back with your stethoscope, he winces in pain from the bruises. You debate whether or not you should call Child Protective Services and report the mother. Please reflect on the following questions in 4-6 sentences Should we completely discount this treatment as useless, or could there be something gained from it? When should a…
