Q: Ex. 35 = Products Formed in Milk: The Litmus Milk Test (p.297) How does the litmus milk test…
A: The Litmus Milk, Oxidase, and Catalase tests are fundamental tools used in microbiology to assess…
Q: One of the systems of diabetes of mellitus (sugar diabetes) is extreme thirst. What brings about…
A: Diabetes mellitus is a chronic disease that happens when the blood glucose levels are high. This…
Q: 2. Gey used "witches' brews" for cell culture media. Researchers using HeLa cells now used a…
A: The introduction sets the stage for discussing the comparison between the "witches' brews" used in…
Q: Autosomal Recessive Disorder: Cystic Fibrosis 2. Cystic fibrosis is lethal autosomal recessive…
A: An autosomal recessive trait is a genetic condition or characteristic that is expressed when an…
Q: Identify the kind of fin shown for each diagram. 1 2 3 4 5 DONE The shape of the caudal fin is DONE…
A: Fish are amazing animals that have evolved to live in different aquatic environments over millions…
Q: B. 7. Which of the following is a precursor for an active form of a digestive enzyme ? A…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Dilution Problem. A culture was diluted as follows: (1) 50mL are added to 100mL of water. (2) 1mL…
A: It refers to the process of reducing the concentration of a substance in a solution by adding more…
Q: When you test cross DdSsNn, you obtain the following numbers of offspring with the following…
A: If the genes are located on the same chromosome then they are classified as linked genes. In that…
Q: 3. A hypothesis must contain which of the following variables? dixet ne zell nosal) bivoga (egn/boot…
A: The element or circumstance that the researcher purposefully modifies or regulates throughout an…
Q: Which division of the autonomic nervous system would likely be activated if a student learned that…
A: When the student realizes they have forgotten about an exam that is about to begin in a few minutes,…
Q: Ex. 33 = Microbial Hydrogen Sulfide (H2S) Production from Thiosulfate and Sulfur-Containing Amino…
A: Answer 1) sulfate is used as an electron acceptor in the bacterial metabolism which is used for…
Q: in end of the 4 stages of mitosis. CIONA LA
A: 1. Interphase: This is the phase before mitosis where the cell prepares for division. During…
Q: Which reaction below is an oxidation reaction? I. 1,3-bisphosphoglycerate (BPG)→…
A: Oxidation is referred to as gain of oxygen or loss of Hydrogen or loss of electrons. It is the…
Q: Figure 8.2: Male vs Female fruit flies The flies in the image below are your ACTUAL data for the…
A: The sex of the drosophila can be determined by their size, because, female drosophila are larger in…
Q: The tRNA is the site on the tRNA molecule that is complementary to a given codon found in the mRNA.…
A: RNA is a type of nucleic acid which is comprised of single-stranded polynucleotide chain and…
Q: It took 25 minutes to kill all the bacteria in a test tube at a temperature of 135 degrees Celsius.…
A: An autoclave is a device that uses high pressure and temperature to sterilize equipment and…
Q: a study to assess the strength of selection on alleles of a gene “B” which affects brightness of the…
A: In the study assessing the strength of selection on alleles of a gene "B" that affects the…
Q: Write the steps involved in making bacterial smear? And what the purpose of doing it before any…
A: Start by sterilizing a microscope slide and allow it to cool. Using a loop or a sterile pipette,…
Q: Two populations of snails live on opposite sides of a city. The frequency of the recessive allele…
A: Migration is the phenomenon of mass movement of population from one regional area to another.…
Q: QUESTION 16 Consider each of the three calculation problems related to DNA extraction. A. What is…
A: These questions are asked to perform calculations related to DNA extraction. The first question asks…
Q: The phylum Chordata only contains vertebrate species. Question 4 options: True False Which…
A: According to our guidelines we can answer only 1 question (up to 3 subparts). You upload all…
Q: What is Schistosomiasis? write a short paragraph about Schistosomiasis
A: A plant or animal that lives on, alongside, or inside a larger species and extracts nutrients is…
Q: Describe stepwise the pre-mRNA processing, how small noncoding RNAs regulate gene expression and…
A: A gene is made up of DNA. It is eventually transcribed into mRNA that helps in the process of…
Q: Based on the information on page 147 Choose the best response. Lactobacillus bulgaricus O…
A: Yogurt, a widely-consumed fermented dairy product, owes its unique taste and texture to the specific…
Q: QUESTIONS 1. What does the gradual change to red indicate in terms of the pH of the solution? 2.…
A: Photosynthesis is the process by which chlorophyll containing organisms produce organic molecule…
Q: (i) A repressor binds to RPA and an activator binds to RPC 1. [Select] 2. [Select] 3. [Select]
A: Gene expression, the process by which information from a gene is used to synthesize a functional…
Q: Personal trainers develop diet and workout plans for professional athletes. If you were a personal…
A: Olympic sprinting is a highly competitive and prestigious athletic event that showcases the pinnacle…
Q: Please explain how bacteria create enzymes in our body to break down molecules using bacterial…
A: Bacterial transcription is the process by which bacteria produce RNA molecules from DNA templates.…
Q: DNA sequence A: 5' - 3' TAACTTAAGGCCAATCGAAATCTTAAGGCGGTATACGCGTTAACCTTAAGG 3' DNA sequence B: 5'…
A: Restriction enzymes are restriction endonucleases that have specific restriction sites and…
Q: The pedigrees are for a rare autosomal trait. What is the chance that individual A is a carrier? 0…
A: 1. Gather family information: Collect detailed information about the family members and their…
Q: Can you say that the microbial composition changes over time in each of the body locations? Give two…
A: In hot summer months, the higher ambient temperature would likely accelerate the decomposition…
Q: 4. What are the two experimental variables in this experimental design? 5. What gas is collecting in…
A: The effect of temperature and food source on yeast fermentation is examined in this experimental…
Q: The glucose in cell culture media diffuses to the cell surface where it is rapidly consumed. The…
A: Diffusion is the process by which substances or particles move from their higher concentration to…
Q: Most species of seafood that are selected for aquaculture are herbivores. True False Farmed…
A: The breeding of a variety of seafood species, comprising carnivores, herbivores, as well as…
Q: How will you measure the the zones of inhibition for exercise 6-7, 6-8 and the Kirby-Bauer meth By…
A: How will you measure the the zones of inhibition for exercise 6-7, 6-8 and the Kirby-Bauer method By…
Q: What can the release of histamine and other chemical mediators from the mast cells in the airways…
A: Immune cells known as mast cells are important components of the immune system. Although they can be…
Q: Is it possible for genetics to create and design a human to our specifications?
A: There has been noteworthy discussion and difference about the concept of utilizing genetics to…
Q: higher mutation rates than others following exposure to UV light
A: Mutation rates in bacteria can vary depending on various factors, including exposure to external…
Q: If a DNA strand with the sequence GGCATGCCTATGCGA is transcribed, which of the following accurately…
A: Transcription is a crucial part of the central dogma of molecular biology. It transfers the genetic…
Q: is located immediately on top of the brain stem contains centers controlling coughing. swallowing,…
A: The swollen part of central nervous system located in brain box, having cavities filled with…
Q: Examples of tumor suppressor genes include? (select all that apply) G1 CDK-cyclins p53…
A: Genes responsible for the suppression of tumors. Acting against the formation of tumors . Tumor…
Q: There is a early part of the finds of the first bipedal hominid to the Ardispithecines and the…
A: The evolutionary process that produced modern humans is represented by the human lineage, commonly…
Q: Green Rf = 0.89 Red Rf = 0.81 Blue Rf = 0.72 Yellow Rf = 0.77 Which colored pigment has the greatest…
A: Chromatography is used to separate and analyze a mixture of components depending on how differently…
Q: 2. Many health issues have been discussed throughout the semester. Identify a lifestyle choice that…
A: Life style change means modifying things we each have control over like changes in diet on daily…
Q: What is the role of Agrobacterium tumefaciens in the production of transgenic plants?
A: Agrobacterium tumefaciens is a natural genetic engineer that inserts its own DNA into the plants it…
Q: Why is an internal location for gas exchange tissues advantageous for terrestrial animals?
A: Breathing is the process by which air enters and exits the lungs. This is accomplished through a…
Q: The sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide…
A: Transcription is the process of converting a portion of DNA into RNA. RNA polymerase is the enzyme…
Q: An individual has a mutation in the gene that codes for the pigment melanin that results in white…
A: Any modification to the DNA sequence that makes up an organism's genome is referred to as a…
Q: Question 4 The following are merozygotes of E. coli with combinations of lac operon mutations.…
A: Lactose (lac) operon is an example of inducable operon. That means when the inducer (lactose) is…
Q: Describe the basic pathway of information flow through neurons that causes you to turn your head…
A: Nervous system in the human body involves in coordination and control various types of activites.…
16
Step by step
Solved in 3 steps
- Describe how you will perform serial dilution. Write and capture your image well.The first picture is all of the procedures then please fill out the table correctly.Gel Electrophoresis is used in many different forms to learn about DNA, RNA or proteins. Research one laboratory method or technique that uses DNA electrophoresis in order to learn more or make determinations about DNA, RNA or Proteins. Name of technique or method Brief description of what the electrophoresis results are used for in the method. Include a link to your resources Include an image of the results or technique you describe
- The functions of the loading dye are: (select all that apply) to prevent sample degradation as gel generates heat to make sure sample sinks to bottom of sample wells so that you can visualize the sample as it runs through the gel so that you can see your bands under UV lightWhich of the following criteria do you feel is the most important one to optimize for a DNA profiling methods? Speed Discriminating power Sensitivity Cost False Positive RateWhen you are trying to find a specimen, you should use; The scanning objective The low/medium power objective The high power objective
- A technique used to determine the tertiary structure of a protein is— high-performance liquid chromatography. high-resolution electrophoresis. X-ray crystallography. ELISA. PCR.How to isolate collagen from fish skin in the laboratory? Please write down each step in detail. Which chemicals are used and how much used. Why are they used, write them in detail. the main steps are as follows Washing and cutting of raw material Chemical pretreatment Extraction Precipitation Freeze-dryingWhich of the following is not an example of aseptic techniques? O Working in the presence of a flame. O Flaming the mouth of the test tube after use. Heat fixing the specimen. Flaming the loop before and after transfer. O Keeping Petri dishes closed when not in use,
- Find a recently developed, automated DNA extraction technique/equipment andexplain it in detailLoaded into first lane of this gel is a DNA sample from a crime scene. The rest of the lanes contain DNA samples from various suspects. Which suspect was likely present at the crime scene? Spec 1 Dad 1 Spect Hilang I Spect 11What molecular biology technique is used to amplify DNA from an evidence sample? Reverse dot blotting Southern hybridization Cloning Polymerase chain reaction (PCR) Capillary electrophoresis