Which best describes the storage of the genetic code? A gene is a segment of DNA, a condensed DNA molecule makes up a chromosome, a chromosome is inside a nucleus, and a nucleus is contained within a cell. A DNA molecule is a segment of a gene, a gene makes up a chromosome, a chromosome is inside a cell, and a cell is contained within a nucleus. A gene is a segment of a chromosome, a condensed chromosome makes up a DNA molecule, a DNA molecule is inside a nucleus, and a nucleus is contained within a cell. A DNA molecule is a segment of a chromosome, a chromosome makes up a gene, a gene is inside a cell, and a cell is contained within a nucleus.

Q: Below is a list of functions related to protein synthesis. Place the number for the function in the…

A: The production of RNA from the DNA is known as the transcription process that occurs within the…

Q: DNA is a chemical that cells use to store information. Describe how information is encoded in DNA,…

A: DNA is Deoxyribo Nucleic Acid which is a complex molecule which consists of two polynucleotide…

Q: Which statement about transcription is correct? O RNA polymerase synthesizes DNA from a DNA…

A: Transcription is defined as the process of copying a DNA template to produce an RNA.  Whereas…

Q: Compare and contrast the DNA and chromosome

A: Inheritance is the process by which this genetic information present in the genes is passed on from…

Q: Which is the correct order from smallest to largest? 1) nucleotide, codon, gene, chromosome 2)…

A: In 1866, Mendel discovered the principle of heredity, demonstrating that genes are found in the…

Q: Use the diagram of a gene below to answer the question. The site of transcription initiation of the…

A: A gene is a sequence of nucleotides in RNA or DNA that encodes for the synthesis of a gene product…

Q: Draw and write about the DNA

A: DNA is double helical in nature. It's structure was discovered by Watson and Crick. It is made up of…

Q: Which is true of the lagging strand in DNA synthesis?   a. It is built elongating towards the…

A: DNA replication is the process by which the DNA generates a copy of itself. It is semi-conservative…

Q: 3 ‘  TACGCCAGTGGTTCGCAC  5   Give the base sequence of the complementary DNA strand.  Give…

A: Base sequence of template strand this 3 ‘  TACGCCAGTGGTTCGCAC  5 is  5' ATGCGGTCACCAAGCGTG 3'   mRNA…

Q: Briefly describe what you know about the structure of DNA and how DNA is packaged in a cell.

A: Nucleic acid was first discovered by Freidrich Mieshcher and was previously called nuclein. Nuclein…

Q: write the difference  between DNA and RNA. Also compare the function of DNA  and RNA .  ( please…

A: The differences between the DNA and RNA are given below.

Q: Name the process by which information from DNA is copied into a new strand of DNA

A: The Process of copying a double-stranded DNA molecule to produce two identical DNA molecules known…

Q: Which statement best describes a genomic library? an initial amount of DNA can be multiplied into…

A: A genomic library is a set of an entire DNA of an organism cloned from the organism's entire body…

Q: Use a drawing to illustrate the principle of DNA gel electrophoresis.

A: Gel electrophoresis is a method which is used to separate the macromolecules such as DNA, RNA,…

Q: Which description best fits the definition of a messenger RNA? a An RNA that encodes for a protein b…

A: RNA is a single-stranded nucleic acid that aids in protein synthesis in our bodies.

Q: Some RNAs Involved in Gene Expression   Brings the appropriate amino acids to the ribosome. Brings…

A: Introduction : The DNA or deoxy ribonucleic acid is the genetic material present in most of the…

Q: nfer what the result would be if the A site on the ribosome was not in the correct conformation…

A: The biochemical substance that is carried from the preceding generation to the succeeding generation…

Q: In DNA cloning, restriction enzymes are used to cut a DNA at specific sites b protein at specific…

A: “Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Refer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends)…

A: The central dogma in both prokaryotic and eukaryotic cell comprises of replication of parent…

Q: Can substitute bases in DNA because of structural similarity.

A: A mutagen is a physical or chemical agent that permanently alters genetic material, usually DNA, in…

Q: name the enzyme which is used to combine or glue two different molecules of a fregment of the DNA

A: Genetic engineering is an advanced biotechnology procedure which is utilized to adjust the genetic…

Q: how does a dna molecule code for a protein

A: Deoxyribonucleic acid or DNA is a molecule that comprises of two polynucleotide chains that wound…

Q: Use the codon table shown above to help answer this question. What protein sequence would a cell…

A: The mRNA sequence is: 5' CCAUGCACCAAUAGAUAACCG 3' The Codon is read in triplet form.

Q: When DNA is read by RNA synthase, mRNA is made. What is the name of the enzyme that reads DNA and…

A: DNA (deoxyribonucleic acid) is the genetic material of all the organisms on the planet except a few…

Q: Diagram a section of DNA being transcribed. Give the various names for the two strands of DNA.

A: Transcription is the process of synthesizing of single-stranded mRNA strand from the double-helical…

Q: The structure of DNA revealed how information is stored in the base sequence along a DNA strand. But…

A: DNA or deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around…

Q: explain what is Discoveries of the Genetic Code

A: The amino acid sequence of proteins is determined by the sequence of nucleotides in deoxyribonucleic…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5 -TGTCCCA-3'…

A: Nucleic acids are the biomolecules composed of nucleotide units. A nucleotide unit is composed of a…

Q: _____________ are the linear sequences of nucleotides in an organism’s genetic information.

A: Cell possess genetic information inside the nucleus in the form of DNA as well as RNA, which act as…

Q: Students are modeling mRNA during the process of protein synthesis. Which answer choice correctly…

A: DNA replication is defined as a type of biological process where the DNA of the organism replicates…

Q: Use the chart to determine the correct amino acid that this DNA would 1 point code for - ATA

A: Introduction:-  In order to determine the gene sequence based off an mRNA template. We can simply…

Q: Predict what might happen if the DNA that coded for a protein contained the wrong base sequence.

A: The DNA sequence of a gene will determine the amino acid sequence of the resulting protein. It takes…

Q: Which process best describes the process of transcription? DNA strands open and both strands are…

A: 1. The process that best describes the process of transcription is: DNA strands open and one strand…

Q: If a sequence of bases on a DNA molecule is GATTACA, what would complimentary MRNA strand look like?…

A: The sequence of bases on a DNA molecule GATTACA the mRNA sequence will be CUAAUGU. Option B

Q: Construct a diagram of a replication fork. Label the 3' and 5' ends of the leading strand, lagging…

A: Replication fork  Is a structure that arises as a result of the replication of DNA. It is formed…

Q: to check  DNA mole

A: Recombinant DNA technology known as "bacterial transformation" is used to introduce a gene of…

Q: Draw a structure of chromosomes

A: Cells are the building blocks of an organism. Cells constitute twelve different organ system of the…

Q: Which is the dominant form of DNA found in the cell?   H   2. Z   3. B   4. A

A: DNA is a deoxyribose sugar made up of different nucleotides. DNA is of three types: A-DNA, B-DNA and…

Q: a) Draw the structure of a nucleotide.

A: According to guidelines we have to answer the first question only. so please kindly post the…

Q: d of a DNA molecule has base that is attached to the # 5 carbon phosphate group that is attached to…

A: DNA is a polynucleotide that is, it is a polymer made up of a monomer called as nucleotide. Every…

Q: Transferring genes into a region of heterochromatin results in gene amplification gene expression…

A: Eukaryotic genomes contain heterochromatin, which serves a variety of purposes including regulating…

Q: The structure of DNA requires both hydrogen bonds and phosphodiester bonds. Describe the location…

A: Introduction Because of bond-polarity-derived attraction forces, two molecules having polar bond…

Q: In protein synthesis, DNA transcription records the genetic message, while ribosomal ______________…

A: DNA is not directly involved in the expression of traits thus it acts as a master copy of genetic…

Q: Use your genetic code (codon) table to answer this question: A tRNA has the anticodon GCU. Which…

A: The anticodon of any one tRNA fits impeccably into the mRNA codon that codes for the amino corrosive…

Q: Which statement correctly describes a codon? a sequence of three nucleotides that may code for one…

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: Write a short essay explaining the evidence that DNA is the genetic material. Be sure to use the…

A: Living organisms have certain specifications, which separate them from the non-livings. The cellular…

Q: Draw & label a simplified diagram of a DNA nucleotide:

A: Deoxyribonucleic acid is a molecule that is composed of two polynucleotide chains that coil around…