Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question
During translation, small organelles called ____ read the mRNA sequence.
These organelles direct transfer RNA, or tRNA, to assemble a specific sequence of ____ ____.
A ____ is a sequence of three mRNA bases that codes for one amino acid.
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 3 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Select the features of a eukaryotic mRNA that are not encoded in the genome. Select all that apply. O Intron O Exon 5' Cap O Poly A tail Promoter O start codonarrow_forwardWhat happens when one base pair of DNA is lost from the coding region of a gene because of mutation? First explain how this would affect the mRNA sequence, and second, explain how this would alter the amino acid of the protein that is encoded.arrow_forwardtranscript the pre-mrna code, ACCUACGCGCCACACGUUCUCUACUAUCCCC, into mature mrnaarrow_forward
- The genetic code is Random in that the codons for the same amino acid are structurally unrelated Read by pairing codons in TRNAS with anticodons in mRNAs Read by pairing anticodons in TRNAS with codons in MRNAS Redundant in that each codon can code for multiple amino acidsarrow_forwardAn mRNA that is translated into one polypeptide is called __________, while an mRNA that is translated into multiple (often related) polypeptides is called __________.arrow_forwardIn protein synthesis, DNA transcription records the genetic message, while ribosomal ______________ interprets the message. ________________ carries the genetic code to the ribosomes to facilitate protein/amino acid synthesis. The genetic message to make a specific amino acid in a protein, is carried by a specific three nucleotide unit on the messenger RNA called a During transcription, the nitrogen base adenine on the DNA bonds with the nitrogen base ______________ on the messenger RNA. The enzyme __________________ unwinds the DNA double helix in DNA transcription.arrow_forward
- Indicate the mRNA sequence, coding sense DNA sequence and template DNA sequence that produced the following polypeptide. The signal “!” means a stop codon:MYCATEATMYRING!arrow_forwardMatch each term with the most appropriate description. sites for polypeptide assembly binds to ribosomes to begin translation a tRNA triplet complementary to a mRNA codon complex with proteins to form ribosomesarrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education