The gene encoding the protein/enzyme: a) DNA ligase b) the B clamp c) primase

Q: Which of the following sequences is most likely to be recognized and cut by a 6- cutter restriction…

A: Restriction enzyme is an enzyme that cuts DNA into small fragments at specific sites within…

Q: Give an example of a mutagen that can change cytosine to uracil.Which DNA repair system(s) would be…

A: Introduction: Chemical compounds or radiation that possess the ability to cause heritable and…

Q: The BamH1 enzyme comes at a concentration of 100,000 U/ml. You are asked to digest 20 ug of DNA with…

A: The term "specific activity" describes the amount of an enzyme's enzymatic activity that is produced…

Q: In the scenario where a single strand break occurs in the DNA replication fork: a) What would happen…

A:

Q: A silent mutation and a missense mutation can both result from

A: Transition mutation refers to a point mutation that changes a purine nucleotide to another purine (A…

Q: O c) Frameshift mutation

A:

Q: True or false: After chromosomal replication, Type I topoisomerase is used to coil up the…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: GENETICS if/when a "whole-genome shotgun" approach is used for DNA sequencing, which of the…

A: DNA sequencing method is the method used for determination of the nucleotide sequence order of a DNA…

Q: Explain how oxidation of a substrate proceeds without oxygen.

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: Why do adult human cells (other than germ cells and stem cells) NOT express the enzyme telomerase?…

A: Telomerase expression is required for cell immortalization ( in cancer cells) and long term tumour…

Q: Is there any situation in which DNA is made based on a RNA template? What is the enzyme involved?

A: ANSWER;-  The cycle in which DNA is synthesized having as a layout an RNA chain is called reverse…

Q: Short tandem repeat sequences (STRs) are a) used for DNA profiles b) repeat sequences present in…

A: STRs  ( short tandem repeat sequences) analysis is used as a method in molecular biology to compare…

Q: In one, simple sentence define the function of the following 1. Helicase  =  2. Alpha subunit of…

A: DNA helicases are essential during DNA replication because they separate double-stranded DNA into…

Q: A). Briefly describe the function of telomerase. B). How does the structure of telomerase allow it…

A: Hello! Since you have posted multiple questions, we are answering the first question only. Kindly…

Q: Select the sequences that would be recognized by a restriction enzyme? (There can be more than one…

A: Restriction enzymes are a group of enzymes that can cut double-stranded DNA. They are endonucleases…

Q: The DNA molecules in eukaryotes including humans are negatively supercoiled while that in…

A: Genetics is a part of science worried about the investigation of qualities, hereditary variety, and…

Q: Where does a restriction endonuclease cuts DNA?a) Ligation siteb) Recognition sequencec) Orid)…

A: Restriction endonucleases are enzymes that cut the DNA strand at a specific sequence. They are…

Q: Using a diagram, and 3-5 sentences, explain the relationship between cell immortality and telomerase…

A: Each time a cell divides, the telomeres get shorter. Telomeres are a region of repetitive nucleotide…

Q: After sequencing a segment of DNA you identify the following sequence: 5…

A: Answer: DNA sequence : It is the genetic sequence or the order of nucleic acids in DNA.  DNA…

Q: D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key…

A: The self replicating biomolecules that are present in the chromosomes and carry genetic information…

Q: (i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z…

A:

Q: How are "sticky ends" generated in DNA? A) by gel electrophoresis O B) by cutting with restriction…

A: Sticky ends or the conhesive ends are the overhangs created in a Dna strand, generally using an…

Q: Shown is a representation of a DNA molecule being transcribed.(a) Identify every 3′ end and every 5′…

A: Transcription is the process in which the codes in DNA are transcribed to mRNA. This helps to…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…

A: DNA (deoxyribonucleic acid) is a double-stranded nucleotide sequence that is intertwined and…

Q: Telomerase is a reverse transcriptase enzyme that carries its own RNA molecule (Figure 1(a)). The…

A: Telomerase is an enzyme which maintain the length of the telomeres of chromosome by adding the…

Q: 2a) With the aid of diagrams, describe the critical role of restriction enzymes in genetic…

A: Genetic Engineering is combining DNA from two or more different organisms to create recombinant DNA.

Q: There are 2 parts to this question: The following DNA strand (below) is about to undergo DNA…

A: The cellular functions are regulated/controlled by the DNA present within the nucleus of the cell.…

Q: It is desired to isolate genomic DNA from liquid culture of S. cerevisiae yeast. A commercial kit…

A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: Below is a schematic of the molecule that inserts the fourth amino acid (a trytophan) into the…

A: tRNA is a transfer Ribonucleic acid molecule that helps decode the mRNA sequence to convert it into…

Q: double-stranded length of DNA is exposed to a restriction enzyme.  The enzyme finds 3 recognition…

A: Restriction enzymes Restriction enzymes are the specific enzymes that cleave the DNA in very…

Q: For linear 34,000 kb DNA calculate a) contour length; b) the length of DNA as packaged in…

A: Introduction "DNA Is A Molecule That Carries And Transmits Hereditary Information Or Genetic…

Q: Name the enzymes that cut the DNA at specific sequences and create sticky ends.

A: A substance produced by a living organism that acts as a catalyst to bring about a specific…

Q: Which of the following items do not affect the melting temperature of DNA? A length of the DNA B the…

A: Melting temperature ( Tm): half of DNA gets denatured (melts). Tm = 2* (A+T) + 4* (G+C)

Q: Which statement is TRUE regarding the DNA ligase mechanism?

A: DNA ligases DNA ligases are the enzymes that are responsible for joining the two strands of DNA by…

Q: a) enzymes are used to assemble an insulin gene, which is then attached to bacterial DNA. b)…

A: Enzymes are biological catalysts that enhance the speed of a reaction. This is performed by lowering…

Q: The activity of restriction enzymes may produce fragments with sticky ends.  Sticky ends are   a) a…

A: Correct option is (c). Restriction enzyme, also called as restrictions endonucleases,  is a…

Q: Give the name of the enzyme that catalyzes each of the following reactions:(a) Makes a DNA strand…

A: Transcription is the first of several steps of DNA based gene expression in which a particular…

Genetic Recombination

Recombination is crucial to this process because it allows genes to be reassorted into diverse combinations. Genetic recombination is the process of combining genetic components from two different origins into a single unit. In prokaryotes, genetic recombination takes place by the unilateral transfer of deoxyribonucleic acid. It includes transduction, transformation, and conjugation. The genetic exchange occurring between homologous deoxyribonucleic acid sequences (DNA) from two different sources is termed general recombination. For this to happen, an identical sequence of the two recombining molecules is required. The process of genetic exchange which occurs in eukaryotes during sexual reproduction such as meiosis is an example of this type of genetic recombination.

Microbial Genetics

Genes are the functional units of heredity. They transfer characteristic information from parents to the offspring.