After several rounds of replication, if COVID19 RNA changes from  5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’ to  5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAG …. 3’    Which of the following describes the above event?  a) an insertion mutation occurred b) a duplication mutation occurred  c) a multi-points mutation occurred  d) a point-series mutation occurred e) an inversion mutation occurred

3. The CAS9 enzyme (shown in red in the image below) is able to target and cut out specific DNA sequences. a) What are the molecular building blocks of CAS9? b) Explain in a few sentences how these building blocks come together to make something as complex and functional as CAS9. What types of interactions hold CAS9 together? c) What are the molecular building blocks of DNA? d) What type of linkage is broken when CAS9 cuts out a piece of DNA? e) How many base pairs would need to be cut out of a DNA sequence that codes for a protein consisting of 317 amino acids?

40) What external factor (aka, damaging agent) gives rise to the following DNA mutations? Write and DRAW the structure of these external damaging agents. A) interstrand crosslinks CH2 HN NH H2N NH2 DNA DNA B) 3-methyladenine 3-meA NH2 CH3 C) 1, N2-etheno-dG N- dR 1,N2-E-dGuo

For the experiment shown Fig. 6.30 and 6.31, what is the advantage to use a labeled incoming nucleotide (α-32P-UTP or α-32P-CTP), not labeled reagent 1 itself? Please draw a diagram to help explain your answer by contrasting the RNA polymerase labeled with α-32P-Reagent (Panel A) vs α-32P-UTP (Panel B).

Identify the most mistaken (wrong) choice: a) Transcription machinery and an enhancer can bind to the chromosome at the same time.  b) Organic matters may interfere with heat treatment of bacterial growth control. ( c) Nitrocellulose can be used to filter out microorganisms from a liquid solution. d) Time to kill a bacterial culture is not proportional to the number of microbes in the culture

Please answer asap