After several rounds of replication, if COVID19 RNA changes from  5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’ to  5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAG …. 3’    Which of the following describes the above event?  a) an insertion mutation occurred b) a duplication mutation occurred  c) a multi-points mutation occurred  d) a point-series mutation occurred e) an inversion mutation occurred

Q: Briefly describe the importance of origin of replication in a cosmid and where are the cos sites…

A: Cosmid vectors are hybrids between plasmid and phage λ vectors.  Cosmid vectors are used in…

Q: 18)(recall) RNA polymerase moves along the template strand of DNA in the DIRECTION, and adds…

A: As per the guidelines we are supposed to answer only the first question, in case of multiple…

Q: 1) Which of the following are referred to as retrotransposons? a) VNTRS b) SINES c) LINES d) STRS 2)…

A: As per our honor code, we are authorized to answer only one question at a moment. So, we are…

Q: 1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also…

A: The polymerization of amino acids according to the codons on mRNA to form proteins is known as…

Q: DNA ligase has the ability to relax supercoiled circular DNA in the presence of AMP but not in its…

A: DNA ligase is the enzyme connecting two DNA strands together. It does so by bonding the phosphate…

Q: Why is it important to restore displaced histones to the DNA following transcription? A) to reform…

A: The process of transcribing information from a strand of DNA into a new messenger RNA molecule is…

Q: (Q134) What is the function of topoisomerase? A) To facilitate unwinding by introducing positive…

A: The process by which a DNA molecule synthesizers it's own identical copies is known as DNA…

Q: 5" i) RNA iv) POLYMERASE RNA-DNA hybrid region NTPs v) X Nucleotide being added to the vi) end of…

A: The image describes transcription. Transcription is a process in which RNA polymerase  helps in the…

Q: Enter title... UV radiation damages DNA by causing... a) frame-shift mutations b) base substitutions…

A: Changes in sequence of DNA is called mutations. These mutation maybe beneficial harmful or neutral…

Q: Cmet-leu-phe-arg-glu-glu lou-ser-tou E)met-arg-glu-arg-glu-arg 231frecall) Agarose gel…

A: DNA, or deoxyribonucleic acid, is a molecule that holds the biological instructions that distinguish…

Q: 93. Which is a common function for the protein product of a cancer-causing gene? a) a role in DNA…

A: Cancer-causing genes, like the name implies are genes that lead to the development of cancer. We…

Q: Which of the following could be used to repair a single nucleotide error in replication or a damaged…

A: Gene mutations are rare and random changes in DNA sequence which result in alteration of polypeptide…

Q: If the four deoxynucleotides showed nonspecific basepairing (A to C, A to G, T to G, and so on),…

A: Proof-reading is an integral part of the replication process. This process reduces the chances of…

Q: Codon optimization is a widely used process for recombinant expression in prokaryotic systems.…

A: The codon is comprised of three nucleotides or triplets of bases. A nucleotide refers to a molecule…

Q: The amino acids in a normal polypeptide chain are proline, arginine, aspartic acid, lysine, and…

A: The DNA sequence of a gene is altered to generate a different result, which is known as a genetic…

Q: 12. A sequence of nucleotides is shown below, along with an indication of an origin of replication:…

A: Replication is the process of synthesizing new DNA from the parental DNA.

Q: 17. Which pair of scientists discovered the structure of the DNA double helix and helped to make…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: 61. Which pairs of restriction enzymes would allow the cloning of the HGH cDNA 3' (downstream) of…

A: Nucleases are enzymes that degrade nucleic acids. They can be classified intoRNase   : enzymes that…

Q: Which of the following statements concerning the sequence of events involved in the initiation of…

A: Transcription is a process in which RNA transcript is formed from the DNA with the help of RNA…

Q: Inhibiting the reverse transcriptase of HIV is a common method for treating HIV infections. a) The…

A: HIV is an RNA virus which has reverse transcriptase enzyme that can convert the RNA to DNA.

Q: 13. An investigator is studying epigenetic markers in patients with retinoblastoma. It is most…

A: Retinoblastoma is a form of cancer that develops in the retina of the eye. It is rare and life…

Q: Match the following terms related to transcription in eukaryotes (you may use terms more than once…

A: RNA polymerase (RNAP) is an enzyme that transcribes RNA using DNA as the template. In Eukaryotes…

Q: What would be the a.) Product of replication b.) Product bof transcription of the following fragment…

A: Deoxyribonucleic acid or DNA is a type of nucleic acid present in the nucleus of the cell. It is a…

Q: CRISPR-Cas9 is used by bacteria as a type of immune system against invading viruses. In recent…

A: The question is asking about the type of DNA repair system that is most likely responsible for the…

Q: new dNTPs can be added at the start of replication, this is done by an enzyme called      RNA…

A: DNA is made up of deoxyribonucleotides. DNA exist in two strands and both the strands are linked by…

Q: DNA ligase has the ability to relax supercoiled circular DNA in the presence of AMP but not in its…

A: (a). The DNA supercoiling is the manifestation of a structural strain in the DNA by a twisting of…

Q: There may be more than one correct answer for each Which of the following motifs can be found in…

A: Introduction :- A motif is a short, recurring sequence of nucleotides in DNA or amino acids in a…

Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: DNA replication is the process by which the DNA is copied in the cell to make up more number of DNA…

Q: Shown is a representation of a DNA molecule being transcribed.(a) Identify every 3′ end and every 5′…

A: Transcription is the process in which the codes in DNA are transcribed to mRNA. This helps to…

Q: 92. You have sequenced a short piece of DNA (by chain termination sequencing) and produced the gel…

A: As we know we have to depict the sequence of any amino acid sequence transcribed from 5' end to 3'…

Q: DNA-binding proteins interact predominantly within which portion of a double-stranded DNA helix? A)…

A: dna is the genetic material , which store all the biological informations.

Q: strand) tom strand) er a few rounds of replication, what will the sequence of the mutated top strand…

A: In the given DNA sequence, the original top strand was5'- TAGCATGCAA - 3'.When guanines in this…

Q: (a) Which of the following statements is TRUE?     DNA polymerase moves in a 5 to 3 direction in…

A: The biological process by which the information encoded inside a DNA (deoxyribonucleic acid)…

Q: A mutation takes place that switches a codon from ACG to ACA. What type of mutation is this? A)…

A: A mutation is a random change in the DNA sequence.

Q: Match the letters with the enzyymes and macromolecules invoived DNA replication: A B INCOMING…

A: There are number of processes necessary for the continuation of generation , growth and…

Q: The authors investigate if the switch from the polymerase to the exonuclease site involves releasing…

A: During DNA replication, accuracy is determined by rate of nucleotide incorporation by DNA…

Q: In sequencing methods, the role of the electrophoresis is a)To stop the replication at that base…

A: Electrophoresis is a technique used in DNA sequencing methods to separate DNA fragments based on…

Q: Identify the type of point mutation on the following strands (transition or transversion):  a. 5’…

A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…

Q: Please provide explanation for each step

A: The objective of the question is to identify the DNA sequence that is palindromic when…

Q: 9. Below is a schematic of an origin of replication. a) Would replication in the top strand in…

A: The enzyme used for the process of DNA replication is the DNA polymerase enzyme. The characteristic…

Q: For each DNA repair process in column I, list all characteristics fromcolumn II that correctly…

A: Although genetic variation are important for evolution, the survival of the individual demands…

Q: 8. A mutant that has a nutritional requirement for growth is an example of a(n) A) heterotroph B)…

A: Mutation in biology is a change in the extrachromosomal genetic material, the virus, or the…

Q: What is Mutation 2? a) Synonymous b) Read through c) Nonsynonymous d) Nonsense Mutation 2 ATA…

A: Mutations are sudden heritable change in the DNA sequence that alters the amino acids and then the…

Q: The first 15 bases of the original informational strand of DNA (which continues after what is shown)…

A: Mutation is the change in DNA sequence caused due to various factors. Mutations take place during…

Q: SPOI.

A: The principle cytotoxic lesion for radio-mimetic chemicals and…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.