After several rounds of replication, if COVID19 RNA changes from  5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’ to  5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAG …. 3’    Which of the following describes the above event?  a) an insertion mutation occurred b) a duplication mutation occurred  c) a multi-points mutation occurred  d) a point-series mutation occurred e) an inversion mutation occurred

Q: Briefly describe the importance of origin of replication in a cosmid and where are the cos sites…

A: Cosmid vectors are hybrids between plasmid and phage λ vectors.  Cosmid vectors are used in…

Q: 18)(recall) RNA polymerase moves along the template strand of DNA in the DIRECTION, and adds…

A: As per the guidelines we are supposed to answer only the first question, in case of multiple…

Q: 1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also…

A: The polymerization of amino acids according to the codons on mRNA to form proteins is known as…

Q: DNA ligase has the ability to relax supercoiled circular DNA in the presence of AMP but not in its…

A: DNA ligase is the enzyme connecting two DNA strands together. It does so by bonding the phosphate…

Q: Why is it important to restore displaced histones to the DNA following transcription? A) to reform…

A: The process of transcribing information from a strand of DNA into a new messenger RNA molecule is…

Q: Double-stranded breaks are repaired by: a). direct reversal of DNA damage b). recombinational repair…

A: Ionizing radiation and radio-mimetic compounds induce DNA double-strand breaks (DSBs), but they may…

Q: 5" i) RNA iv) POLYMERASE RNA-DNA hybrid region NTPs v) X Nucleotide being added to the vi) end of…

A: The image describes transcription. Transcription is a process in which RNA polymerase  helps in the…

Q: Enter title... UV radiation damages DNA by causing... a) frame-shift mutations b) base substitutions…

A: Changes in sequence of DNA is called mutations. These mutation maybe beneficial harmful or neutral…

Q: Cmet-leu-phe-arg-glu-glu lou-ser-tou E)met-arg-glu-arg-glu-arg 231frecall) Agarose gel…

A: DNA, or deoxyribonucleic acid, is a molecule that holds the biological instructions that distinguish…

Q: Which of the following could be used to repair a single nucleotide error in replication or a damaged…

A: Gene mutations are rare and random changes in DNA sequence which result in alteration of polypeptide…

Q: If the four deoxynucleotides showed nonspecific basepairing (A to C, A to G, T to G, and so on),…

A: Proof-reading is an integral part of the replication process. This process reduces the chances of…

Q: The amino acids in a normal polypeptide chain are proline, arginine, aspartic acid, lysine, and…

A: The DNA sequence of a gene is altered to generate a different result, which is known as a genetic…

Q: 12. A sequence of nucleotides is shown below, along with an indication of an origin of replication:…

A: Replication is the process of synthesizing new DNA from the parental DNA.

Q: 17. Which pair of scientists discovered the structure of the DNA double helix and helped to make…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: If the sequence 5′-AACGC-3′ were damaged by reactive oxygen species, what would be the most…

A: Mutation is the process by which the sequence of DNA is altered and can result in deleterious…

Q: TRUE OR FALSE: a) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can…

A: DNA replication process is semi conservative. The semi conservative replication of DNA refers to the…

Q: Which of the following is NOT correct concerning the initiation of replication in E. coli?…

A: In E.coli, the DNA replication takes place by the binding of DnaA to the OriC (the origin of…

Q: A temperature-sensitive mutation is one in which the defect is not presented functionally until the…

A: Introduction  Enzymes are the biomolecules especially proteins. Which helps in the speeding up of…

Q: What would be the a.) Product of replication b.) Product bof transcription of the following fragment…

A: Deoxyribonucleic acid or DNA is a type of nucleic acid present in the nucleus of the cell. It is a…

Q: During high stress environments, it has been found that some bacteria activate a genetic mechanism…

A: The given enzymes are used in the replication process. It is a process wherein the genetic material,…

Q: DNA ligase has the ability to relax supercoiled circular DNA in the presence of AMP but not in its…

A: (a). The DNA supercoiling is the manifestation of a structural strain in the DNA by a twisting of…

Q: There may be more than one correct answer for each Which of the following motifs can be found in…

A: Introduction :- A motif is a short, recurring sequence of nucleotides in DNA or amino acids in a…

Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: DNA replication is the process by which the DNA is copied in the cell to make up more number of DNA…

Q: Shown is a representation of a DNA molecule being transcribed.(a) Identify every 3′ end and every 5′…

A: Transcription is the process in which the codes in DNA are transcribed to mRNA. This helps to…

Q: 92. You have sequenced a short piece of DNA (by chain termination sequencing) and produced the gel…

A: As we know we have to depict the sequence of any amino acid sequence transcribed from 5' end to 3'…

Q: Figure 2 illustrates the important elements of a cosmid. a) Briefly describe the importance of…

A: In the recombinant DNA technology the foreign DNA or target DNA is inserted into the vector then the…

Q: ) A bacterial chromosome contains 6.4 million nucleotides of DNA. If synthesis at each replication…

A: 1. It is given that a bacterial chromosome contains 6.4 million nucleotides of DNA. Suppose…

Q: Considering the Polymerase Chain Reaction (PCR), we can state that: a) It is a technique that…

A: Introduction: Polymerase chain reaction is a method which is used to amplify a small amount of DNA…

Q: Draw a molecule of DNA undergoing eukaryotic linear replication. On your drawing, identify (a)…

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…

Q: a) If you isolated DNA from the ear and the tail of the same mouse, would you expect the DNA,…

A: The capacity to extract DNA is critical for researching the genetic causes of disease and developing…

Q: In which region(s) will Okazaki fragments be found during new strand synthesis? (see image for…

A: Semi replicative mechanism is a type of DNA mechanism which explained the type of replication…

Q: DNA-binding proteins interact predominantly within which portion of a double-stranded DNA helix? A)…

A: dna is the genetic material , which store all the biological informations.

Q: strand) tom strand) er a few rounds of replication, what will the sequence of the mutated top strand…

A: In the given DNA sequence, the original top strand was5'- TAGCATGCAA - 3'.When guanines in this…

Q: A mutation takes place that switches a codon from ACG to ACA. What type of mutation is this? A)…

A: A mutation is a random change in the DNA sequence.

Q: Match the letters with the enzyymes and macromolecules invoived DNA replication: A B INCOMING…

A: There are number of processes necessary for the continuation of generation , growth and…

Q: The authors investigate if the switch from the polymerase to the exonuclease site involves releasing…

A: During DNA replication, accuracy is determined by rate of nucleotide incorporation by DNA…

Q: What is the purpose of the dideoxynucleotide triphosphates in the Sanger sequencing reaction?

A: In 1977, Sanger proposed chain termination method of DNA sequencing. He used ddNTP or…

Q: 9. Below is a schematic of an origin of replication. a) Would replication in the top strand in…

A: The enzyme used for the process of DNA replication is the DNA polymerase enzyme. The characteristic…

Q: For each DNA repair process in column I, list all characteristics fromcolumn II that correctly…

A: Although genetic variation are important for evolution, the survival of the individual demands…

Q: The first 15 bases of the original informational strand of DNA (which continues after what is shown)…

A: Mutation is the change in DNA sequence caused due to various factors. Mutations take place during…

Q: RNA primase is required for DNA replication a)on the lagging strand to ligate okazaki fragments.…

A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…

Q: SPOI.

A: The principle cytotoxic lesion for radio-mimetic chemicals and…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.