The eukaryotic metallothionein gene promoter consists of all EXCEPT: (A) MRE (в) GC Box c) GRE D Pribnow box

Q: Most structural genes of bacteria are grouped together and transcribed from a single affect…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Based on what you know about the structure of GPCRs, they must have: a)One internal start transfer…

A: Proteins destined for secretion outside the cell or lumen of an organelle are first targeted to the…

Q: gene transcription regulation in eukaryotes that are post-transcriptional/pre-translational:

A:

Q: A) Draw the mRNA to be translated if the pre-mRNA is constitutively spliced. [ 3) Draw an mRNA to be…

A:

Q: describe the process of translation/protein synthesis at the ribosome based on these figures

A: Answer: TRANSLATION = It is the process in central dogma where mRNA is translated in to proteins in…

Q: 1) RNA polymerase 2) sigma (o) subunit of RNA polymerase 3) rho (p) factor 4) transcription factors…

A: RNA polymerase  extend or polymerise RNA.   Sigma subunit of RNA polymerase binds to promoter…

Q: The genetic code was deciphered by experiments in which synthetic polyribonucleotides of known…

A: Hi dear, here's your answer.please like it .

Q: The following DNA sequence has been determined from DNA isolated from a bit of prehistoric amber…

A: Here, a DNA sequence given and we are asked to write the polypeptide formed from this sequence. In…

Q: D D Intron +1 E E A В В C GGGCGG GCCCAATCT TATAAA Intron -5000 -100 -25 1. What region functions…

A: The transcription is the process of conversion DNA to RNA . DNA stands for dioxy ribonucleic acid…

Q: AAUCCCAAU ITTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the…

A: Telomeres are the structures(caps) that are present at the end of the chromosomes, their fhbction is…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: 1.The -glycosidic bond in uridine phosphate exist between a) C1 of ribose and N9 of uracil b) C3 of…

A: 1. The glycosidic linkage involves c-1 of sugar and the hydrogen atom of N-1 in uracil 2 Promoters…

Q: If a gene sequence is more tightly coiled around histones, then which of the following is the most…

A: When DNA or gene sequence is strongly attached to histones, however, transcription factors and RNA…

Q: Spliceosomes play central roles in .. a) removal of exons from pre-mRNA b) removal of introns from…

A: The mRNA transcribed from the DNA is heterogeneous mRNa or pre mRna which is not the final product.…

Q: E 64 In the figure shown below, which of the DNA strands is the template strand, upper or lower?…

A: Ans- The template strand of the DNA serves as a template for synthesis of a complementary RNA…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: A ribosome binds to the following mRNA at the site indicatedby the dark box. At which codon will…

A: The mRNA strands obtained after the transcription of the antisense DNA strand (also known as the…

Q: in m 5'- 3'- Shown below is a schematic diagram illustrating a very short gene with 3000 bp region…

A: Transcription is the process of formation of transcript that is mRNA from DNA. It is catalysed by…

Q: Select the following descriptions of gene transcription regulation in eukaryotes that are…

A: * Post translational modification are covalent and enzymatic modifications of proteins that follows…

Q: In the: Insertion of G after the 2nd T in the TATA box Explain: (a) What is the process affected?…

A: TATA box is a sequence of thymine and Adenosine in the genetic code that tells where the…

Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…

A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.

Q: Provide a detailed description of gene expression and control in prokaryotes. Provide a detailed…

A: Gene expression is the mechanism by which information from a gene is used to create a functioning…

Q: A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what…

A: The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…

Q: Below is a diagram of an Oscar Miller (Christmas tree) spread. Which of the following is true? O a.…

A: Transcription is the second step of central dogma in gene expression involving the synthesis of RNA…

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Describe regulatory mechanisms for each of the following levels. Give at least on example for each…

A: Answer : A) DNA: - Deoxyribose nucleic acid-- DNA is a long polymer of deoxyribonucleotides, DNA…

Q: Usually found in prokaryotes, regulatory sequences lying adjacent to the DNA being transcribed are…

A: In prokaryotes, the process of transcription and translation occur simultaneously due to the lack of…

Q: e: 5 factor that does not dissociate from the RNA polymerase Holoenzyme in: (a) What is the process…

A: Sigma factors are responsible for determining the specificity of promoter of the DNA.

Q: In the presence of cephalosphorin, what will be the protein product of the prokaryotic cell gene…

A: A class of β-lactam antibiotics includes Cephalosporin it is derived from the fungus known as…

Q: Degradation of cyclins is Controlled phosphorylation blubiquitylation c) de phosphorylation d)…

A: Cyclins are a family of proteins that regulate the progression of the cell cycle by binding and…

Q: Which of the following is true of phase variation? A) O It is triggered by stalled ribosomes. B) O…

A: Phase variation is a feature seen in Salmonella, in which it can withstand unfavorable environmental…

Q: In the picture below (representing RNA transcription) match A-E to whether they are 5' or 3' ends. A…

A: The information recorded inside the DNA sequence of one or more genes is transcribed into a strand…

Q: The following polynucleotide was synthesized and used as a template forpeptide synthesis in a…

A: Three consecutive nucleotides form a triplet termed a codon that codes for a single amino acid.…

Q: Identify the following mutations and describe what the possible effect on the protein will be. (4)…

A: Mutation in general refers to the change in one or more gene. Some are negligible while others can…

Q: 1)HSP 70 is a chaperone protein that aids the folding of newly formed polypeptides during…

A: Introduction  Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: (b) Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B- globin are given…

A: RNA strnad given = 5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3' (i) DNA strand from which this mRNA is…

Q: Gene-specific transcription factors interact with DNA to control gene expression. At which surface…

A: Transcription is the process of copying genetic information from one strand of DNA into RNA. The…

Q: What mRNA base sequences are complementary to the following DNA template sequences? Be sure to label…

A: The process by which the mRNA is transcribed from the parental DNA is known as the process of…

Q: Regarding transcriptional promoter sites, which of the following statements are true? Select one or…

A: Introduction  The process of converting a piece of DNA into RNA is known as transcription. Messenger…

Q: Val (V) Ala (A) Arg (R) Ser (S) Lys (K) Start Stop A с U G Using the codon wheel below, identify…

A: Amino acids are organic molecules that are the building blocks of proteins. They are composed of a…

Q: The following prokaryotic DNA is transcribed into RNA and the mRNA transcript is translated into…

A: The central dogma of molecular biology tells us how the genetic information is stored within a cell,…

Q: Human histone H1 protein has the protein sequence as shown as “KKASKPKKAAS-…

A: Histone H1 protein K in the sequence represents lysine The given histone sequence is rich in lysine…

Q: DNA Template: 5' (?) MRNA (?) 3' 3' GGTCAGATGTGCGCGACGGGCAATCCGCACGTGTCATCAATAGTGCCTTCGTCTGAGATC 5'…

A: DNA subsists inside the nucleus as a double-stranded particle. Some regions of DNA include genes…

Q: For the ovalbumin gene shown, indicate the locations of the following: (a) transcription start site,…

A: The transcription start site is the site on the DNA from which the first RNA nucleotide (+1) is…